ID: 1047355663

View in Genome Browser
Species Human (GRCh38)
Location 8:124119334-124119356
Sequence CAGGTTGGACAGATGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047355653_1047355663 26 Left 1047355653 8:124119285-124119307 CCTGAGGCTGTCAGGAAAGACTT 0: 1
1: 0
2: 2
3: 20
4: 250
Right 1047355663 8:124119334-124119356 CAGGTTGGACAGATGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047355663 Original CRISPR CAGGTTGGACAGATGGAGGG TGG Intronic
No off target data available for this crispr