ID: 1047360857

View in Genome Browser
Species Human (GRCh38)
Location 8:124167846-124167868
Sequence CTTGAATGACAGAAGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047360857_1047360860 7 Left 1047360857 8:124167846-124167868 CCAGGTTTCTTCTGTCATTCAAG No data
Right 1047360860 8:124167876-124167898 TTAATTTTTCTGGAATTCTTGGG No data
1047360857_1047360859 6 Left 1047360857 8:124167846-124167868 CCAGGTTTCTTCTGTCATTCAAG No data
Right 1047360859 8:124167875-124167897 TTTAATTTTTCTGGAATTCTTGG No data
1047360857_1047360858 -3 Left 1047360857 8:124167846-124167868 CCAGGTTTCTTCTGTCATTCAAG No data
Right 1047360858 8:124167866-124167888 AAGAGCTCATTTAATTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047360857 Original CRISPR CTTGAATGACAGAAGAAACC TGG (reversed) Intergenic
No off target data available for this crispr