ID: 1047361202

View in Genome Browser
Species Human (GRCh38)
Location 8:124171139-124171161
Sequence AGATTTTCGCTTCTGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047361195_1047361202 7 Left 1047361195 8:124171109-124171131 CCATTTTATATAAAGGACCTGAG No data
Right 1047361202 8:124171139-124171161 AGATTTTCGCTTCTGTTGGGGGG No data
1047361196_1047361202 -10 Left 1047361196 8:124171126-124171148 CCTGAGCATCCTCAGATTTTCGC No data
Right 1047361202 8:124171139-124171161 AGATTTTCGCTTCTGTTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047361202 Original CRISPR AGATTTTCGCTTCTGTTGGG GGG Intergenic
No off target data available for this crispr