ID: 1047362832

View in Genome Browser
Species Human (GRCh38)
Location 8:124184678-124184700
Sequence TTTTAATAATGGTGGGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047362825_1047362832 7 Left 1047362825 8:124184648-124184670 CCCATTTGAATGAAATGCTGAGC No data
Right 1047362832 8:124184678-124184700 TTTTAATAATGGTGGGAAATGGG No data
1047362826_1047362832 6 Left 1047362826 8:124184649-124184671 CCATTTGAATGAAATGCTGAGCT No data
Right 1047362832 8:124184678-124184700 TTTTAATAATGGTGGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047362832 Original CRISPR TTTTAATAATGGTGGGAAAT GGG Intergenic
No off target data available for this crispr