ID: 1047364959

View in Genome Browser
Species Human (GRCh38)
Location 8:124203222-124203244
Sequence CATTTCATGGGGAGGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047364950_1047364959 -2 Left 1047364950 8:124203201-124203223 CCAATAAGCTGTGGAATCGGCCA No data
Right 1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG No data
1047364946_1047364959 10 Left 1047364946 8:124203189-124203211 CCCTGAGACTCACCAATAAGCTG No data
Right 1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG No data
1047364945_1047364959 30 Left 1047364945 8:124203169-124203191 CCTGGCTCTGTCTGTAAACACCC No data
Right 1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG No data
1047364947_1047364959 9 Left 1047364947 8:124203190-124203212 CCTGAGACTCACCAATAAGCTGT No data
Right 1047364959 8:124203222-124203244 CATTTCATGGGGAGGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047364959 Original CRISPR CATTTCATGGGGAGGGTGGG TGG Intergenic
No off target data available for this crispr