ID: 1047367222

View in Genome Browser
Species Human (GRCh38)
Location 8:124222648-124222670
Sequence CAGTGGAAGGAGAGGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047367222_1047367241 29 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367241 8:124222700-124222722 GCTGGGGGGAGGGCGGGGGGAGG No data
1047367222_1047367237 23 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367237 8:124222694-124222716 AGTATGGCTGGGGGGAGGGCGGG No data
1047367222_1047367235 19 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367235 8:124222690-124222712 GTGAAGTATGGCTGGGGGGAGGG No data
1047367222_1047367229 11 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367229 8:124222682-124222704 CAAGGAATGTGAAGTATGGCTGG No data
1047367222_1047367226 -7 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367226 8:124222664-124222686 TCCACTGAGATTCTGAAACAAGG No data
1047367222_1047367238 24 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367238 8:124222695-124222717 GTATGGCTGGGGGGAGGGCGGGG No data
1047367222_1047367230 12 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367230 8:124222683-124222705 AAGGAATGTGAAGTATGGCTGGG No data
1047367222_1047367232 14 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367232 8:124222685-124222707 GGAATGTGAAGTATGGCTGGGGG No data
1047367222_1047367240 26 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367240 8:124222697-124222719 ATGGCTGGGGGGAGGGCGGGGGG No data
1047367222_1047367233 15 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367233 8:124222686-124222708 GAATGTGAAGTATGGCTGGGGGG No data
1047367222_1047367231 13 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367231 8:124222684-124222706 AGGAATGTGAAGTATGGCTGGGG No data
1047367222_1047367234 18 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367234 8:124222689-124222711 TGTGAAGTATGGCTGGGGGGAGG No data
1047367222_1047367239 25 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367239 8:124222696-124222718 TATGGCTGGGGGGAGGGCGGGGG No data
1047367222_1047367228 7 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367228 8:124222678-124222700 GAAACAAGGAATGTGAAGTATGG No data
1047367222_1047367236 22 Left 1047367222 8:124222648-124222670 CCTGTTACCCTCTCCTTCCACTG No data
Right 1047367236 8:124222693-124222715 AAGTATGGCTGGGGGGAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047367222 Original CRISPR CAGTGGAAGGAGAGGGTAAC AGG (reversed) Intergenic
No off target data available for this crispr