ID: 1047367559

View in Genome Browser
Species Human (GRCh38)
Location 8:124225963-124225985
Sequence TCCCATTGGCTTTTCTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047367559_1047367562 6 Left 1047367559 8:124225963-124225985 CCAGGATAGAAAAGCCAATGGGA No data
Right 1047367562 8:124225992-124226014 TGGACGTAGAAACCATGACTTGG No data
1047367559_1047367564 26 Left 1047367559 8:124225963-124225985 CCAGGATAGAAAAGCCAATGGGA No data
Right 1047367564 8:124226012-124226034 TGGAAGCAGAAGTTGAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047367559 Original CRISPR TCCCATTGGCTTTTCTATCC TGG (reversed) Intergenic