ID: 1047372588

View in Genome Browser
Species Human (GRCh38)
Location 8:124268119-124268141
Sequence AAGTTTCTGCAGCAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047372588_1047372591 9 Left 1047372588 8:124268119-124268141 CCTGCCATCTGCTGCAGAAACTT No data
Right 1047372591 8:124268151-124268173 GAAACTTGTCCAAGAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047372588 Original CRISPR AAGTTTCTGCAGCAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr