ID: 1047373730

View in Genome Browser
Species Human (GRCh38)
Location 8:124277018-124277040
Sequence ACACGCCAGGATTTACCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047373730_1047373738 22 Left 1047373730 8:124277018-124277040 CCCCCAGGTAAATCCTGGCGTGT No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373730_1047373736 0 Left 1047373730 8:124277018-124277040 CCCCCAGGTAAATCCTGGCGTGT No data
Right 1047373736 8:124277041-124277063 TGAGGACCTGATGCTATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047373730 Original CRISPR ACACGCCAGGATTTACCTGG GGG (reversed) Intergenic
No off target data available for this crispr