ID: 1047373731

View in Genome Browser
Species Human (GRCh38)
Location 8:124277019-124277041
Sequence AACACGCCAGGATTTACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047373731_1047373738 21 Left 1047373731 8:124277019-124277041 CCCCAGGTAAATCCTGGCGTGTT No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373731_1047373736 -1 Left 1047373731 8:124277019-124277041 CCCCAGGTAAATCCTGGCGTGTT No data
Right 1047373736 8:124277041-124277063 TGAGGACCTGATGCTATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047373731 Original CRISPR AACACGCCAGGATTTACCTG GGG (reversed) Intergenic
No off target data available for this crispr