ID: 1047373735

View in Genome Browser
Species Human (GRCh38)
Location 8:124277031-124277053
Sequence CATCAGGTCCTCAACACGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047373735_1047373738 9 Left 1047373735 8:124277031-124277053 CCTGGCGTGTTGAGGACCTGATG No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047373735 Original CRISPR CATCAGGTCCTCAACACGCC AGG (reversed) Intergenic
No off target data available for this crispr