ID: 1047373737

View in Genome Browser
Species Human (GRCh38)
Location 8:124277047-124277069
Sequence GGAAATCCATTGATAGCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047373737_1047373745 21 Left 1047373737 8:124277047-124277069 CCTGATGCTATCAATGGATTTCC No data
Right 1047373745 8:124277091-124277113 CTCCATACTGCCCCTCAACTGGG No data
1047373737_1047373738 -7 Left 1047373737 8:124277047-124277069 CCTGATGCTATCAATGGATTTCC No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373737_1047373744 20 Left 1047373737 8:124277047-124277069 CCTGATGCTATCAATGGATTTCC No data
Right 1047373744 8:124277090-124277112 CCTCCATACTGCCCCTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047373737 Original CRISPR GGAAATCCATTGATAGCATC AGG (reversed) Intergenic
No off target data available for this crispr