ID: 1047373738

View in Genome Browser
Species Human (GRCh38)
Location 8:124277063-124277085
Sequence GATTTCCACTGATGCTTTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047373730_1047373738 22 Left 1047373730 8:124277018-124277040 CCCCCAGGTAAATCCTGGCGTGT No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373731_1047373738 21 Left 1047373731 8:124277019-124277041 CCCCAGGTAAATCCTGGCGTGTT No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373737_1047373738 -7 Left 1047373737 8:124277047-124277069 CCTGATGCTATCAATGGATTTCC No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373735_1047373738 9 Left 1047373735 8:124277031-124277053 CCTGGCGTGTTGAGGACCTGATG No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373728_1047373738 27 Left 1047373728 8:124277013-124277035 CCAAGCCCCCAGGTAAATCCTGG No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373732_1047373738 20 Left 1047373732 8:124277020-124277042 CCCAGGTAAATCCTGGCGTGTTG No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data
1047373733_1047373738 19 Left 1047373733 8:124277021-124277043 CCAGGTAAATCCTGGCGTGTTGA No data
Right 1047373738 8:124277063-124277085 GATTTCCACTGATGCTTTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047373738 Original CRISPR GATTTCCACTGATGCTTTAA CGG Intergenic
No off target data available for this crispr