ID: 1047377647

View in Genome Browser
Species Human (GRCh38)
Location 8:124317800-124317822
Sequence TCAGAGCCAGCAAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 1, 2: 9, 3: 55, 4: 598}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047377647_1047377651 4 Left 1047377647 8:124317800-124317822 CCTTTCTCCCTTGCTGGCTCTGA 0: 1
1: 1
2: 9
3: 55
4: 598
Right 1047377651 8:124317827-124317849 GCAGGCTGCCATGTTGTGAGAGG No data
1047377647_1047377655 18 Left 1047377647 8:124317800-124317822 CCTTTCTCCCTTGCTGGCTCTGA 0: 1
1: 1
2: 9
3: 55
4: 598
Right 1047377655 8:124317841-124317863 TGTGAGAGGGTCTACTGAGAGGG No data
1047377647_1047377652 5 Left 1047377647 8:124317800-124317822 CCTTTCTCCCTTGCTGGCTCTGA 0: 1
1: 1
2: 9
3: 55
4: 598
Right 1047377652 8:124317828-124317850 CAGGCTGCCATGTTGTGAGAGGG No data
1047377647_1047377654 17 Left 1047377647 8:124317800-124317822 CCTTTCTCCCTTGCTGGCTCTGA 0: 1
1: 1
2: 9
3: 55
4: 598
Right 1047377654 8:124317840-124317862 TTGTGAGAGGGTCTACTGAGAGG No data
1047377647_1047377656 26 Left 1047377647 8:124317800-124317822 CCTTTCTCCCTTGCTGGCTCTGA 0: 1
1: 1
2: 9
3: 55
4: 598
Right 1047377656 8:124317849-124317871 GGTCTACTGAGAGGGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047377647 Original CRISPR TCAGAGCCAGCAAGGGAGAA AGG (reversed) Intronic
900156033 1:1203607-1203629 TCAGGGCCAGCAAGGGAGGAAGG + Exonic
900179628 1:1305515-1305537 GGAGAGCCAGCAAGGGGGGATGG + Intronic
900181593 1:1313434-1313456 TCAGAGACAGCATGGGTGGAAGG + Intronic
900986433 1:6075666-6075688 TCCGAGCCAGCAGGGAAGCAAGG + Intronic
901233143 1:7652308-7652330 TCAGAGCAAGCAGGAGAGGAAGG - Intronic
901536638 1:9886727-9886749 TCTGAGCCAGCGAGGGGGACGGG + Intronic
902090928 1:13902531-13902553 CCAGAGGCAGGAAGGGAGACAGG + Intergenic
902212082 1:14911614-14911636 TCAGTGCCAGCAGGGGCCAAGGG - Intronic
902335311 1:15751157-15751179 TCAGAGCCCACCAGGGAGAGGGG + Intergenic
902839134 1:19064428-19064450 GGACAGCCAGCAAGGAAGAATGG - Intergenic
903149675 1:21397935-21397957 TCAGAGACAGAAAAAGAGAAGGG + Intergenic
903575674 1:24338185-24338207 TCAGAGCCAGGTAGGGAAACAGG - Intronic
903575748 1:24338568-24338590 ACACAGCCAGGAAGGGAGTAAGG - Intronic
903669455 1:25026926-25026948 GCAGAGCCAGCAGGGGAGGCTGG + Intergenic
903820050 1:26095023-26095045 GCAGGGCCAGCCTGGGAGAAGGG + Intergenic
904462758 1:30690053-30690075 TTACAGGCAGCAAGGGATAAAGG - Intergenic
904465328 1:30704347-30704369 TCAGAGCCACCCAGGGAGTGGGG - Intergenic
905282007 1:36855267-36855289 TCAGAATCTGCAAGGGAGCATGG - Intronic
905764360 1:40587731-40587753 TCAGAGGAAGGAAAGGAGAACGG - Intergenic
908846718 1:68332271-68332293 TCAGAGAGAGGGAGGGAGAAAGG + Intergenic
909024818 1:70469570-70469592 TTAAAGGCAGCTAGGGAGAAGGG + Intergenic
909068616 1:70965053-70965075 TCACATACAGAAAGGGAGAAGGG + Intronic
909231838 1:73101311-73101333 TTAAAGGCAGCAAGAGAGAAGGG + Intergenic
909982298 1:82117069-82117091 TTATGGCCAGAAAGGGAGAAGGG + Intergenic
910082722 1:83360644-83360666 CCAAAGTCAGCTAGGGAGAAGGG - Intergenic
910670180 1:89764326-89764348 ACAGAGTGAACAAGGGAGAAAGG - Intronic
911310553 1:96287736-96287758 TTAAAGGCAGCAAGAGAGAAAGG - Intergenic
911752312 1:101509584-101509606 CCAGAGCCAGCAGGGAAGCAGGG - Intergenic
911821531 1:102430008-102430030 TCAGAGAGAGAAAGAGAGAAGGG - Intergenic
912581783 1:110727541-110727563 ACTGAGCCAGCCAGGGAGACAGG + Intergenic
912891872 1:113541982-113542004 TAGGAGCCAGCAAGGCAAAAAGG - Intronic
913095101 1:115509236-115509258 AAAGAGTCAGCAAGGGAGATAGG + Intergenic
913095928 1:115515124-115515146 AGAGAGTCAGCAAGGGAGATAGG + Intergenic
914457497 1:147849796-147849818 TGACAGCCAGCAAGAGAGCAGGG - Intergenic
914870078 1:151466238-151466260 TCAGAGCCTGCCAGGAAGCAAGG - Intergenic
915300503 1:154948704-154948726 GAAGAGCCAGGGAGGGAGAATGG - Intronic
915606951 1:156958431-156958453 TTAGAGGCAGGAAGGGAGAGAGG + Intronic
915812697 1:158931596-158931618 TCAAAGACAACAAGGGAAAATGG - Exonic
916013242 1:160725629-160725651 TCACAGCCAGCATGAGGGAAAGG + Intergenic
916322810 1:163523430-163523452 AGAGAGCCAGCATAGGAGAAGGG - Intergenic
916986745 1:170199938-170199960 TGAGAGACAGGAAGGAAGAAAGG + Intergenic
917661339 1:177180275-177180297 TCAGAGCCACCCAGGGTGGAAGG - Intronic
918104065 1:181401263-181401285 TCAGGGTCAGCAAGGCAGGAAGG - Intergenic
918559276 1:185845094-185845116 TCAAAGCCAGCTTAGGAGAATGG + Intronic
919146722 1:193644947-193644969 TCAGAGCCAGCAGGCAGGAACGG + Intergenic
920527986 1:206682999-206683021 TCAGAGGCAGCAAGGCACAGTGG - Intronic
921015155 1:211183013-211183035 GCAGAGCCAGCAAAGGAGACAGG + Intergenic
921811116 1:219515677-219515699 TCGGAGTCAGCAAGCGAGACTGG - Intergenic
922241729 1:223759865-223759887 GCAGAGCCACCAAGGGTGTAAGG + Intronic
922390599 1:225137848-225137870 CCACAGCCAGCCAGGTAGAATGG + Intronic
922591272 1:226779214-226779236 TCAGTTCCAGCAAGGGAGCAAGG - Intergenic
923301866 1:232648794-232648816 TCAGAGCAAACAGGTGAGAAGGG + Intergenic
924280950 1:242436975-242436997 TTAGACAAAGCAAGGGAGAATGG + Intronic
924315612 1:242792307-242792329 TCAGAGCCAGGGAGGGAGAAAGG - Intergenic
1063387378 10:5624574-5624596 TCAGAGAAAGCAAGCGAGAATGG - Intergenic
1063423866 10:5936300-5936322 TTAGAGGAAGTAAGGGAGAACGG + Intronic
1064133071 10:12727279-12727301 TCAGAGACATCAAAGCAGAATGG + Intronic
1064383501 10:14868347-14868369 TCAGAGGCAGCATGGCACAATGG - Intronic
1065688063 10:28305688-28305710 TCAGCGCCTGCAAGGGAGCAGGG + Intronic
1065945665 10:30603842-30603864 TCTCAGCCATCAAGGGGGAAAGG + Intergenic
1067031277 10:42879883-42879905 TCAGGGCCAGGAAGGGACAAGGG + Intergenic
1067977431 10:51042017-51042039 TCTGAGCCAGCAAAGTAAAATGG + Intronic
1069557238 10:69406464-69406486 TCAGAGACAGCCAGGAAGGAGGG - Intronic
1069624114 10:69856908-69856930 TCAGAGCCAGCAAAGTGCAACGG + Intronic
1069769159 10:70886851-70886873 TCAGAGAAAGCAAGGAAGCAAGG + Intronic
1070089165 10:73267857-73267879 TGAGAGCCAGCAAGGAAACAGGG - Intronic
1070187273 10:74076542-74076564 TCAGAGCCCGCAAAGAAGACTGG - Intronic
1071334798 10:84591619-84591641 TCAGAGCCTTGTAGGGAGAAAGG - Intergenic
1071517721 10:86310129-86310151 TCAGAGCCAGCAGGAGAGCCAGG - Intronic
1071674764 10:87645023-87645045 TCAGAGGGAGCCAGGGAGACAGG + Intergenic
1073355440 10:102850161-102850183 TCACAGCCGGCAAGAGAGAGAGG + Intergenic
1073706450 10:105989630-105989652 TCAGAGCCTGCTAGGGTCAAGGG - Intergenic
1075611960 10:123861656-123861678 TCAGAGCCAGCAAAGGCAGATGG - Intronic
1075682800 10:124344335-124344357 TCACAGCCAGCAACGGTGAGTGG + Intergenic
1075754542 10:124800698-124800720 AGAGAGTCAGCAAGGGAGATAGG - Intergenic
1075916007 10:126168023-126168045 TCTGGGACAGGAAGGGAGAAAGG - Intronic
1077235836 11:1481685-1481707 CCAGAGCCAGGCAGGGAGCAGGG + Intronic
1078086910 11:8239399-8239421 GCAGAGCCAGCAAGGGGGCATGG + Intronic
1078120792 11:8506894-8506916 TCAGAGTAAGCAGGGGAGAAAGG - Intronic
1078266506 11:9759187-9759209 ACAGAGACAGCCAGGGAGAGAGG + Intergenic
1078614686 11:12854245-12854267 GGAGAGCCAGGGAGGGAGAAGGG - Intronic
1079267235 11:18944981-18945003 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1079423326 11:20315840-20315862 TGTGGGGCAGCAAGGGAGAAGGG + Intergenic
1079738034 11:24022361-24022383 ACAAAGCAAGCAATGGAGAAAGG - Intergenic
1079921071 11:26435327-26435349 TTAAAGGCAGCTAGGGAGAAAGG - Intronic
1080561148 11:33464313-33464335 ACAGAGCAACCAAGGGACAAGGG - Intergenic
1080918989 11:36689734-36689756 TAGGAGACAGGAAGGGAGAAAGG - Intergenic
1081083406 11:38770405-38770427 TCAAAGACAGCTAGAGAGAAAGG + Intergenic
1081534576 11:43987625-43987647 GCAGAGCCAGCCAGGGAGTGGGG - Intergenic
1081741763 11:45445937-45445959 AAAGAGCCAGGAGGGGAGAAGGG - Intergenic
1082118442 11:48352730-48352752 TTAGAGCCAGAAAGGGAGTTTGG - Intergenic
1082866057 11:57901275-57901297 GAAGAGCCAGGAAGGGAGACAGG - Intergenic
1083378333 11:62244142-62244164 TCAGAGGCAGCCAGGCAGAGAGG - Intronic
1083611011 11:64004294-64004316 TCAGAGCCAGCAGAGGCGGAAGG + Intronic
1083614003 11:64017672-64017694 CCAGAGCCAGCGAGGGAGGAGGG + Intronic
1084139512 11:67215928-67215950 TCACATCCATCAAGGGGGAAAGG + Exonic
1084264136 11:67996193-67996215 TAAGAGCCAGGTGGGGAGAAGGG + Intronic
1084443740 11:69191305-69191327 GCAGAGAAATCAAGGGAGAAAGG - Intergenic
1085324603 11:75596875-75596897 TCAGAGCAAGCGAGGGACAGAGG + Intronic
1085810582 11:79677402-79677424 GCAGATCCAGCAGGGGATAAAGG + Intergenic
1085868024 11:80317673-80317695 TCAGACTTGGCAAGGGAGAAAGG - Intergenic
1086035695 11:82411458-82411480 TCTGGGCCAGGAAGAGAGAATGG + Intergenic
1086168571 11:83808857-83808879 TGAGACCCTGCAGGGGAGAATGG - Intronic
1086260346 11:84932377-84932399 TCAAATCAAGCAATGGAGAAAGG - Intronic
1086361117 11:86060649-86060671 CCACTGCCAGCAAAGGAGAAAGG + Intronic
1086568975 11:88261484-88261506 TCAAAGGCAGCTAGAGAGAAAGG - Intergenic
1087625867 11:100595393-100595415 GCAGAGCTAGGAAGGGATAAAGG - Intergenic
1087749986 11:101996700-101996722 TCAGAGACTGAAAAGGAGAAAGG + Intronic
1087796429 11:102459204-102459226 TCAGAGGCAGCAAAGAGGAATGG - Intronic
1088101383 11:106159841-106159863 TCAAAGTCAGCATGGAAGAAAGG - Intergenic
1088630259 11:111767181-111767203 TCAGAGGCAGCAAGGGGAAGAGG + Intergenic
1089800914 11:121025920-121025942 TCAGACACAGCAAAGGATAAAGG - Intronic
1090017309 11:123097705-123097727 TCAGAGCCAGAAAGAAAGACTGG + Intronic
1090816361 11:130300115-130300137 TCAGAGACAGAAAAGTAGAAGGG + Intronic
1090846328 11:130532815-130532837 TGAGAGGAAGCAAGAGAGAAGGG - Intergenic
1090982328 11:131734343-131734365 TCAGAGTCAGAAAGGGTCAAGGG - Intronic
1091593708 12:1860700-1860722 TCAAAGACACCCAGGGAGAAGGG + Intronic
1091747625 12:3002876-3002898 TCAGAGCCCTCCAGGGACAATGG + Intronic
1091775421 12:3181833-3181855 TCAGATACAGCAAAGGAGCAAGG - Intronic
1092289818 12:7153123-7153145 TCAGGGACAGCAAGGAAGAAGGG - Intronic
1092575715 12:9780814-9780836 TTAAAGCCAGCTAGAGAGAAGGG - Intergenic
1093448455 12:19287535-19287557 CCAGAGCCTCCAAGGGAAAACGG + Exonic
1093877851 12:24371250-24371272 TAACAGCCAGCAAGGAAGCAAGG + Intergenic
1094015681 12:25860829-25860851 TCAGAGCAAGATGGGGAGAACGG - Intergenic
1095470724 12:42534266-42534288 TGAGAGCCCGCCAGGAAGAATGG + Intronic
1095624710 12:44301354-44301376 GCAGAGTCAGCAAAGGGGAAGGG + Intronic
1095743839 12:45635605-45635627 GAAGAGCCAGAAAGCGAGAAAGG + Intergenic
1097190066 12:57215390-57215412 TCAGAGACACCCAGGGAGACAGG - Intergenic
1097422027 12:59391733-59391755 TCAAGGCCAGCCAGAGAGAAAGG + Intergenic
1097438585 12:59581378-59581400 TCAGATCAAGCTAGGGTGAATGG - Intergenic
1098609009 12:72432097-72432119 TCAGGCCCAGCAAAGGAGAAAGG - Intronic
1098835162 12:75415692-75415714 TCAGAGCCAGCAAGAAAACAAGG - Intronic
1099572856 12:84347372-84347394 TCAAAGGCAGCTAGAGAGAAGGG - Intergenic
1100019032 12:90047580-90047602 TCAAAGCCAAAAAGGGAAAAAGG - Intergenic
1100379670 12:94049802-94049824 TGACAGCCAGCAAGGGAACAGGG - Intergenic
1100462948 12:94818888-94818910 TCACAGCCAGCACCAGAGAAAGG + Intergenic
1100596798 12:96078704-96078726 TCAGAGCCAGACGGGGAGAGGGG - Intergenic
1100616156 12:96233311-96233333 TCAGTGCCAGCAAGGACAAAAGG - Intronic
1100769290 12:97903428-97903450 TCAGAGACAGGAAGAGAGAGAGG + Intergenic
1101037821 12:100722409-100722431 TCAAAGGCAACAAGAGAGAAGGG - Intronic
1101549597 12:105749698-105749720 TCAGAGAGAGAAAGAGAGAAAGG - Intergenic
1101599555 12:106197373-106197395 TCAGAAGCTGCAGGGGAGAAGGG + Intergenic
1102576717 12:113860381-113860403 TCAAAGCCAGCATGGCAGAGGGG - Intronic
1102583631 12:113908108-113908130 TGAGAGCCAGCCAGGCAGGATGG - Intronic
1102708151 12:114900596-114900618 TCACATCCAGCAAGGCAGATGGG + Intergenic
1102811192 12:115825288-115825310 CCAAAACCAGCAAGGGAGAGAGG + Intergenic
1104219372 12:126767259-126767281 CCAGTGCCAGCAAGGGAAGAGGG - Intergenic
1104259336 12:127168227-127168249 TTATAACCAGCAAGGGTGAATGG + Intergenic
1105281177 13:18963583-18963605 TCAGAGCCAGTGAGGGAGGAGGG - Intergenic
1105290381 13:19049599-19049621 TCAGAGCCAGTGAGGGAGGAAGG - Intergenic
1106653876 13:31721304-31721326 TCTGAGCCAGAACGGGAGAGAGG - Intergenic
1106987565 13:35373014-35373036 TCAGAGCCTCCAAGGGCCAAGGG + Intronic
1107391135 13:39965420-39965442 TCAGAGGCAGCAAGCGAGAAGGG - Intergenic
1107544942 13:41426356-41426378 TAAGAGCCAGGAGGGGAGAAGGG + Intergenic
1108053102 13:46464376-46464398 TCAGAGCCAGGGGGGGAGAGGGG - Intergenic
1108082438 13:46750657-46750679 TCTGAGCCCCCAATGGAGAAGGG - Intronic
1108140422 13:47415514-47415536 TCTTAGCCAGCATGGGATAAAGG + Intergenic
1109473670 13:62847659-62847681 TCAGCCCCAGCAAGAGATAATGG - Intergenic
1109926721 13:69151568-69151590 TAATAGCCAGCAGGGGAGAGGGG + Intergenic
1110010191 13:70323260-70323282 GCAAAGGCAGTAAGGGAGAAGGG - Intergenic
1111759445 13:92443149-92443171 TGAGAGCAAGCAAGAGAGAGGGG + Intronic
1113503693 13:110798490-110798512 TCAGAGCCAGCCTAGGAGATTGG + Intergenic
1113947277 13:114051314-114051336 GGAGAGCCAGGAAGGGAGGAGGG - Intronic
1114499181 14:23155365-23155387 AGAGAGCCAGGAAGGGAGGAGGG - Intronic
1114825643 14:26074953-26074975 TCAGAGGAAGGAAGGAAGAAAGG + Intergenic
1114973152 14:28059571-28059593 TGAGAGGAAGCAAGAGAGAAAGG - Intergenic
1115770690 14:36662117-36662139 TCAGAGCCGGGAAGGGAGGGAGG + Intronic
1117047275 14:51826202-51826224 GCAGAGCCAGCAAGAGCGGATGG + Intronic
1117837618 14:59823679-59823701 TCAAAGGCAGCTAGAGAGAAGGG - Intronic
1118243293 14:64082549-64082571 TGAGAGCCAGCAAGGAAACAGGG + Intronic
1118940243 14:70328224-70328246 TGAGTCCCAACAAGGGAGAAGGG + Intronic
1120101300 14:80448816-80448838 AAACAGGCAGCAAGGGAGAAGGG - Intergenic
1121242250 14:92439319-92439341 ACAGAGCCTGCAAAGGAGAGAGG - Exonic
1121266036 14:92603251-92603273 TAACAGCCAGCAAAAGAGAAAGG + Intronic
1121590065 14:95098359-95098381 CCAGAGCAAGGTAGGGAGAATGG + Intronic
1121863831 14:97343860-97343882 TCAGAGCCAGCAACTGAGGGTGG - Intergenic
1121915317 14:97832834-97832856 ACAGAGAGAGCAAGAGAGAAGGG + Intergenic
1122309851 14:100787611-100787633 CCAGAACCATCAAGGGAGACAGG + Intergenic
1123018290 14:105385859-105385881 TGAGAGCCCGCACGGGAGAGGGG + Intronic
1123189001 14:106550064-106550086 AGAGAGACAGCAAGGGAGACGGG - Intergenic
1202836597 14_GL000009v2_random:81880-81902 TTAAAGGCAGCTAGGGAGAAAGG + Intergenic
1123496479 15:20832289-20832311 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
1123553717 15:21405879-21405901 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
1123589959 15:21843244-21843266 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
1124843902 15:33271850-33271872 TCAGAGCCAAAAAGAGAGATAGG - Intergenic
1124845975 15:33290362-33290384 TGAGACCCAGCAAGGACGAAAGG + Intergenic
1125188916 15:36966876-36966898 TCAGAGCCAGCTAGGAAGGCAGG + Intronic
1125365140 15:38905449-38905471 GAAGGGCCAGAAAGGGAGAAGGG + Intergenic
1125544784 15:40495166-40495188 TGAGAGGGAGCAAGGGAGAGAGG + Intergenic
1125604461 15:40932094-40932116 CCAGGGCCAGCAGGTGAGAATGG + Intronic
1126099157 15:45109495-45109517 TCAGAGCCAGAAGGGGTGGATGG - Intronic
1126232661 15:46345030-46345052 TCAGAGCCAGCCAGGTGGAAAGG - Intergenic
1126277435 15:46900669-46900691 TGAGAGCCAGCAAAGTGGAAAGG + Intergenic
1126693699 15:51308233-51308255 TCAGAGCCAGCAATGAGGACAGG + Intronic
1126703789 15:51389079-51389101 TCAGGGCCAGTAAGGGGTAAAGG - Intronic
1127044802 15:55014158-55014180 TCAGAGAAAGAAAAGGAGAAAGG - Intergenic
1127335299 15:57978706-57978728 TCAGGCCCAGAAGGGGAGAAGGG + Intronic
1128046312 15:64620787-64620809 TCAGAGCCAACTGTGGAGAATGG + Intronic
1128675601 15:69606378-69606400 ACAGAGCTAGCAAAGGAGGATGG - Intergenic
1128809098 15:70557040-70557062 TCACATCCACCGAGGGAGAAGGG - Intergenic
1129114681 15:73358638-73358660 TCAGAGTCCTCAAGGGTGAAGGG + Intronic
1129157891 15:73730201-73730223 TAAGACGCAGCAAGGCAGAAAGG + Intergenic
1129597294 15:76974795-76974817 CCAGGGCCAGCCAGGGACAATGG - Intergenic
1129671325 15:77609445-77609467 TCACAGAGAGCAAGGGAGAAGGG - Intergenic
1129868351 15:78925574-78925596 CCAGAGACAGGAAGGGAGAGAGG - Intronic
1130644360 15:85710674-85710696 TCAGAACCAGAAAGTCAGAAAGG - Intronic
1130669134 15:85894927-85894949 TCAGAGGCAGTGAGGGAGCAGGG + Intergenic
1130675373 15:85947515-85947537 ACACAGCCAGTAAGGGAGTAAGG - Intergenic
1130786573 15:87104209-87104231 TCAGGGCCTGCAAGGGTCAAGGG - Intergenic
1130921901 15:88353852-88353874 TGACAGCCAGCAAGGAAGCAAGG + Intergenic
1131074649 15:89487339-89487361 GCAGAGCCACCCAGGGAGGAGGG - Intronic
1131151907 15:90052552-90052574 ACAGAGCCAGTAAGAGATAAAGG - Intronic
1131727429 15:95242553-95242575 TCAGAGTCATCAAGGAAGGAAGG + Intergenic
1202962061 15_KI270727v1_random:133075-133097 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
1132681442 16:1144097-1144119 TCACAGCCAGGCAGGGAGACAGG + Intergenic
1133121502 16:3611434-3611456 ACGGAGCCAGCGAGGGAGACGGG + Intronic
1133773890 16:8883460-8883482 ACACAGCCAGCATGGGAGCAGGG - Intergenic
1134596065 16:15496945-15496967 TCAAAGCCAGCAATGGTGAATGG - Intronic
1135303961 16:21353163-21353185 TCAGAGGCACCTTGGGAGAAGGG + Intergenic
1135994852 16:27240241-27240263 TCAGAGTCACCAAGAGAGACTGG + Intronic
1136300694 16:29332300-29332322 TCAGAGGCACCTTGGGAGAAGGG + Intergenic
1136381527 16:29898253-29898275 ACAGCGCCAGCAAGGCAGAGGGG + Intronic
1137693440 16:50445800-50445822 TCAGAGCGTGCAGGGGTGAAAGG - Intergenic
1138522932 16:57581994-57582016 TCACAGCCAGTACGGGGGAAAGG - Intronic
1138712522 16:58985979-58986001 TCAGGGCCTGCAAGGGCCAAGGG - Intergenic
1139011635 16:62642175-62642197 TCAGAGCAAGCAAATGAGAAGGG - Intergenic
1139021393 16:62754132-62754154 TCAGAGCAAGCAAGCAAGAGTGG - Intergenic
1140577468 16:76187757-76187779 TTAAAGGCAGCTAGGGAGAAGGG + Intergenic
1140630288 16:76844390-76844412 TTAAAGGCAGCTAGGGAGAAGGG - Intergenic
1141707936 16:85679310-85679332 TCAAAGCCAGCAAGGGATGAAGG + Intronic
1142062422 16:88039093-88039115 TCAGAGGCACCTTGGGAGAAGGG + Intronic
1142532635 17:592795-592817 TCAGGGGCAGCCAGAGAGAAAGG - Intronic
1142885468 17:2909788-2909810 TCAGAGCTGGGAAGGGAGGAAGG + Intronic
1143069305 17:4277089-4277111 TCAGAGGCAGCAAGTGAGAGAGG - Intronic
1143087434 17:4426690-4426712 TCAGAGCCAGTCAGGGACTAGGG - Intergenic
1145384065 17:22401879-22401901 ACAGAGAGAGAAAGGGAGAATGG - Intergenic
1146454049 17:32995725-32995747 TCAGGGCCCGCCAGGGAGAGGGG - Intronic
1146908963 17:36635750-36635772 GCAGAACCAGCAAGCTAGAAGGG + Intergenic
1146966310 17:37033965-37033987 GTAGAGCAAGCAAGGGAGAAGGG + Intronic
1147521654 17:41178976-41178998 TTAGAGCTAGGAAGGCAGAAAGG - Intergenic
1148332730 17:46821764-46821786 TCCGAGCCAGCTAGAGAGAGGGG - Intronic
1148798743 17:50210197-50210219 TCAGACCCAGAAAGGGACAGGGG + Intergenic
1149398262 17:56267103-56267125 TGAGAGCTAGGAAGGGAGCAAGG - Intronic
1150713190 17:67548934-67548956 TCAGGGCCTGCAAAGGAAAATGG - Intronic
1150720750 17:67612289-67612311 CCAGAGCAAGGAAGAGAGAAAGG + Intronic
1151352546 17:73540206-73540228 TCAGAGCCTCCGAGGGAGCAGGG + Intronic
1151870006 17:76830248-76830270 TCAGAGCCGGCGAGAGAGAGAGG + Intergenic
1152016939 17:77756981-77757003 TCAGAGGCAGCAAGGCAGGGTGG - Intergenic
1152023852 17:77796361-77796383 TCCCAGGCAGCAAGGGAGACTGG + Intergenic
1152293218 17:79452599-79452621 TTAGGGCCATCAGGGGAGAATGG + Intronic
1152937500 17:83148908-83148930 TCAGGGCCAGCACAGGACAAAGG - Intergenic
1154057948 18:11029736-11029758 TCAGAGGCAGGGAGGGAGAGGGG - Intronic
1154228030 18:12526254-12526276 TGAGAGCAAGCAAGGTAGAAGGG - Intronic
1154398733 18:14014518-14014540 TCAGAGGCAGGAAAGAAGAAAGG - Intergenic
1154454395 18:14507972-14507994 TTAAAGGCAGCTAGGGAGAAAGG - Intronic
1155040722 18:22063511-22063533 TCAGAGCCAGACAGAGGGAAGGG + Intergenic
1155332211 18:24729883-24729905 TCGGAGGCAGCAAGGGAGACTGG - Intergenic
1156719156 18:40048972-40048994 CCAGAGCCAGCTTGGAAGAACGG + Intergenic
1156864743 18:41876165-41876187 TCACAGCCTGAAAGGGAAAATGG + Intergenic
1156939702 18:42752557-42752579 TGAGAGACAGCAAGAAAGAAGGG - Intronic
1157003739 18:43557983-43558005 TCAAAGGCAGCTAGAGAGAAGGG - Intergenic
1158174418 18:54638329-54638351 TCAGATCCAGGAAGGGATGATGG - Intergenic
1158316879 18:56221049-56221071 TCAGAGCCAGACAGGAAGAGAGG + Intergenic
1158574415 18:58624080-58624102 TCAGAGCCAACAAAGCAGGAAGG - Intronic
1158696464 18:59708490-59708512 TCAGAGTCAGGGAAGGAGAAAGG - Intergenic
1158735516 18:60075081-60075103 TCAGAGCCTGCAAGGGTCAAGGG - Intergenic
1159137446 18:64352744-64352766 TGAGAGCGAGCAGGGTAGAAAGG + Intergenic
1159386664 18:67735065-67735087 ACAGAGACAGTAAGGGAGAGAGG - Intergenic
1159622329 18:70652483-70652505 TCAAAGACAGCAATGCAGAAAGG - Intergenic
1159868164 18:73730396-73730418 TTACAGCCAGCAAGGAAGAGAGG - Intergenic
1159964575 18:74582765-74582787 TCAGATCCTGGAAGGGAAAAAGG + Intronic
1160296148 18:77638794-77638816 TCAGATTCAGCAAGGTTGAAAGG + Intergenic
1161043930 19:2124375-2124397 GCAGAGTCAGCAAAGGGGAATGG - Intronic
1161242652 19:3231041-3231063 TCAGAGCCATCCAGGGAGGCTGG + Intronic
1162514306 19:11138877-11138899 TCACTGCCTGCAAGGGAGGAGGG - Intronic
1162542997 19:11309402-11309424 ACAGAGTGAGCAAGGGGGAAAGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1162846509 19:13396899-13396921 TCAGAACCAGGGAGGGAGCAGGG - Intronic
1163036040 19:14569541-14569563 CCAGAGTAAGCAAGAGAGAAGGG + Intronic
1163850803 19:19662349-19662371 TCAGAGCCAGCCAGGGTGGGGGG + Intronic
1164806075 19:31118113-31118135 CAAGAGACAGGAAGGGAGAAAGG + Intergenic
1165068160 19:33240909-33240931 CCAGAGCCACCAAGAGAGGAAGG - Intergenic
1165834122 19:38743999-38744021 TCAGGGCCAGCAGGGAAGTAAGG + Exonic
1165844564 19:38809894-38809916 TCAGGGCCAGGAGGGGAGCAGGG - Intronic
1166136654 19:40781376-40781398 TCAGAGGCAGAGAGGGAGACAGG + Intronic
1166558740 19:43718477-43718499 TCAGCGCCTGCAGAGGAGAAGGG - Exonic
1166663816 19:44665054-44665076 ACAGAGCCAGGAATGGAGAGTGG + Intronic
1167378353 19:49124381-49124403 TCAGAGCCTGCTAGGGATGAAGG - Intronic
1167612696 19:50514993-50515015 ACAGAGCCAGGAAGGGGGCAGGG + Intergenic
1202636040 1_KI270706v1_random:45482-45504 TTAAAGGCAGCCAGGGAGAAAGG - Intergenic
925277183 2:2658601-2658623 ACAGAGCCAGCAGGAGAGAGAGG + Intergenic
925338357 2:3115161-3115183 GGAGAGCCAGCAAAGGAGACTGG + Intergenic
926567148 2:14488642-14488664 TCAGAACCAACATGTGAGAATGG - Intergenic
927256396 2:21044022-21044044 TCAGCGGCAGCAACCGAGAAGGG + Exonic
927513845 2:23660569-23660591 TCATAGCCAAAAAGGGACAAGGG + Intronic
927565257 2:24106196-24106218 TCAAAGGCAGCTAGAGAGAAAGG + Intronic
929111649 2:38409989-38410011 AAAGAGCCAGAGAGGGAGAAGGG + Intergenic
929195862 2:39183620-39183642 GCAAAACCTGCAAGGGAGAAGGG - Intronic
929399366 2:41562389-41562411 TCAGAGCCATCCTGGGAGAATGG - Intergenic
929459519 2:42092161-42092183 TCAGAGCAAGCACAGGAGAGGGG - Intergenic
931525839 2:63152033-63152055 TCAGAGACAGAGAGGGAGAAGGG + Intronic
931861558 2:66360016-66360038 TGAGAGCCAGCAAGCAAGAGAGG - Intergenic
932105917 2:68942805-68942827 TTAAAGACAGCTAGGGAGAAGGG - Intergenic
933012096 2:77078949-77078971 TCAGTGGCAGAAGGGGAGAATGG + Intronic
934512653 2:94958826-94958848 TTACAGACAGCAAGGAAGAACGG + Intergenic
934545141 2:95207872-95207894 GCAGAGGGAGAAAGGGAGAAAGG + Intronic
935528237 2:104199297-104199319 TCAGAGACAGCAAAGGAGTCTGG - Intergenic
935549241 2:104434502-104434524 ACAGAACCAGCAAGCCAGAAAGG + Intergenic
935740573 2:106143909-106143931 TCAAAGGCAGCAACAGAGAATGG - Intronic
936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG + Intronic
937618607 2:123958182-123958204 TCAGAGCAAGTCAAGGAGAATGG - Intergenic
937681162 2:124646230-124646252 ACAGAGCTAGTGAGGGAGAAAGG + Intronic
938167345 2:129042587-129042609 TCAGAGTCACCAAAGGTGAAAGG - Intergenic
938749243 2:134312993-134313015 TCAGAGCAAGGAAGGAAAAAGGG - Intronic
939360957 2:141171920-141171942 TAAGAGACAGCCAGAGAGAAAGG - Intronic
939577418 2:143912894-143912916 TCAAAGCCAGCAAGAGAGAAAGG + Intergenic
940575907 2:155503782-155503804 TTAAAGGCAGCAAGAGAGAAGGG + Intergenic
940619124 2:156088809-156088831 TCTGAGTCAGCAGAGGAGAATGG - Intergenic
941718232 2:168786309-168786331 TCACAGCCAGCACGAGGGAAAGG + Intergenic
942582058 2:177429870-177429892 TCAGAGCCAGCAGGCTGGAAAGG + Intronic
943311918 2:186335883-186335905 TGAGAGTCAACTAGGGAGAAGGG - Intergenic
943349964 2:186785574-186785596 CCAGAGCCAGCAAGCTAGAATGG - Intergenic
944382482 2:199127439-199127461 TCAGAGCCAGCAATGGCTAGTGG - Intergenic
944838726 2:203605292-203605314 TCAGAGCCACCAATAAAGAAGGG - Intergenic
945296051 2:208172449-208172471 ACTGTGCCAGCAAGGGAGAGTGG - Intronic
945430412 2:209756773-209756795 TTAAAGGCAGCAAGAGAGAAGGG + Intergenic
945844037 2:214921770-214921792 TTAAAGCCAGGAAGGGAGAGAGG + Intergenic
947339894 2:229127215-229127237 TCCCAGCCAGCAAGAGAGAGGGG - Intronic
947364316 2:229378491-229378513 GCAGAGGCAGCAAGGAAGACAGG + Intronic
947637978 2:231689724-231689746 TCAGAGCCAGCAGGGGGGCGGGG - Intergenic
948047996 2:234958338-234958360 TCAGAGCCAGCCATGGTGAGCGG + Intronic
948676583 2:239600584-239600606 ACAGAGAAAGAAAGGGAGAAAGG + Intergenic
1168761451 20:352905-352927 ACAGAGACAGGAAGGTAGAAAGG + Intronic
1168865874 20:1086096-1086118 ACAGAGTGAGCAAGGGAGAATGG + Intergenic
1169225262 20:3852522-3852544 TTAGAGCCAGGAAGGGAGCCAGG + Intronic
1170234538 20:14087501-14087523 GCAGAAGCAGCAAAGGAGAAAGG - Intronic
1170335789 20:15268685-15268707 TCAAAGCCAGTAAGGAAAAAGGG - Intronic
1171168181 20:22991982-22992004 TTAAGGCCAGCAAGAGAGAAAGG - Intergenic
1172912703 20:38421791-38421813 AGAGAGCCAGCAAGGGAGGGAGG + Intergenic
1173838738 20:46142454-46142476 GCAGAGTGAGCAAGGGAGAGAGG - Intergenic
1174378111 20:50139551-50139573 GAAGAGCCAGCAAGGGAGGCTGG - Intronic
1175466985 20:59195914-59195936 TCTGAGCCAGAATGGAAGAAAGG + Exonic
1175613543 20:60372800-60372822 TCAAAGCTAGCAAGGGAGAGAGG - Intergenic
1175754220 20:61519164-61519186 TCACAGTCCGCAAGGAAGAAGGG + Intronic
1175898965 20:62352545-62352567 TCAAAGCGTGCAAGGGAGAGCGG - Intronic
1175960538 20:62634379-62634401 TCAGAACCAGCCCAGGAGAAGGG + Intergenic
1176819774 21:13645327-13645349 TTAAAGGCAGCTAGGGAGAAAGG + Intergenic
1177260553 21:18724700-18724722 TCAGGGCCTGCAAGGGCCAAGGG - Intergenic
1177931024 21:27283784-27283806 TAACAGCCAGCAAGGAAGCAGGG - Intergenic
1177979208 21:27889645-27889667 TAAGTGTCTGCAAGGGAGAAGGG - Intergenic
1179711868 21:43268178-43268200 TCAGGACCACTAAGGGAGAAGGG - Intergenic
1180215100 21:46318605-46318627 TCAGAGCAAGCAGGGAAGACAGG + Intronic
1180364677 22:11927753-11927775 TTAAAGGCAGCCAGGGAGAAAGG + Intergenic
1181544713 22:23595529-23595551 TCAGAGGCAACTAGGCAGAAAGG - Intergenic
1181815600 22:25434366-25434388 TCAGAGGCAACTAGGTAGAAAGG + Intergenic
1182094950 22:27619833-27619855 TCAGAGACAGCAGAGAAGAAGGG + Intergenic
1182153336 22:28047017-28047039 TCAGAGACGGCCAGAGAGAAGGG + Intronic
1182706260 22:32282442-32282464 AAAGAGCCAGCAAGGGAGTGAGG - Intergenic
1184496898 22:44847182-44847204 TCAGAGCCAGAAAGAGAAACAGG - Intronic
1184975299 22:48057514-48057536 AAATAGGCAGCAAGGGAGAAGGG + Intergenic
1185219463 22:49622235-49622257 TGAGAGCCGTCAAGGGAGACAGG + Intronic
1185236373 22:49715848-49715870 TCAGAGCCGGTTTGGGAGAAAGG + Intergenic
949382300 3:3459812-3459834 TCTGGGCCAGCAAGGGCAAATGG + Intergenic
950426191 3:12925929-12925951 TCTGAGGCCCCAAGGGAGAAGGG - Intronic
950582474 3:13871608-13871630 TAAGGGCCAGCTAGGAAGAAGGG - Intronic
950689981 3:14647839-14647861 TCAGATCCAGCGAGGGAGGAAGG + Intergenic
950774280 3:15336284-15336306 ACAGAGACAGCCAGGGAGAGAGG + Intronic
950866384 3:16192652-16192674 TCAGCCCCACCAGGGGAGAAGGG + Intronic
950922802 3:16712400-16712422 TCAGAAACAACAAGGGAGAAGGG - Intergenic
951134162 3:19083926-19083948 CCACTGCCAGCAAGGGCGAAGGG - Intergenic
951380301 3:21976002-21976024 TCAGAGCCTTCAAAGAAGAATGG + Intronic
951772290 3:26272005-26272027 CCAGAGACAGAAAGGCAGAAGGG - Intergenic
953568736 3:44054704-44054726 TCAGTGCCCGGAAGGAAGAAGGG + Intergenic
953853624 3:46484594-46484616 TCAGTTCCAGCATGGGAGGAGGG - Intronic
953964924 3:47296975-47296997 TCAGATCCAGCAAGGTAGAATGG - Intronic
954107799 3:48418681-48418703 GCAGAGCCAGAAATGGAGTATGG + Intronic
955218597 3:57005459-57005481 TCAAATCAAACAAGGGAGAAAGG + Intronic
955372816 3:58368207-58368229 TGAGAGTCCTCAAGGGAGAAGGG + Intronic
956061856 3:65356480-65356502 ACAGAGCCAGCCACCGAGAAAGG - Exonic
956612893 3:71142598-71142620 TGACAGCCAGCAAGGAAGCAGGG + Intronic
957307278 3:78473841-78473863 TTAAAGCCAGCTAGAGAGAAAGG + Intergenic
957570211 3:81937325-81937347 CCAGGGCCATCCAGGGAGAAGGG + Intergenic
957686948 3:83514586-83514608 AGAGAGTCAGCAAGGGAGATGGG + Intergenic
957690174 3:83556438-83556460 TCAGCACTAGCAAGGGAAAACGG + Intergenic
957700843 3:83708864-83708886 TAAAAACCAGCAAGGGGGAAAGG + Intergenic
957909814 3:86606824-86606846 AGAGAGGCAGCAAGGGAGAGAGG + Intergenic
959249007 3:103916174-103916196 AGAGATCCAGCAAGGTAGAATGG - Intergenic
959596128 3:108130277-108130299 TGGGAGGCAGCAAGGGAGAAGGG + Intergenic
959699205 3:109282438-109282460 TGAGAGGCAGCAAGAGAGAGAGG + Intergenic
960187872 3:114666044-114666066 TCAGAGAATGCAAGGGACAAAGG - Intronic
961167620 3:124774376-124774398 TGAGAGGGAGCAAGGGAGACTGG + Intronic
961658254 3:128454909-128454931 TCAGAGTCAGAAAAGGAGACTGG + Intergenic
962464716 3:135647525-135647547 TTAAAGCCAGCTAGAGAGAAAGG - Intergenic
963090438 3:141478584-141478606 TCAGAGATAGAAAGAGAGAACGG + Intergenic
963758205 3:149258578-149258600 TCAGGGCCTGCAAGGGCTAAGGG - Intergenic
964647777 3:158977106-158977128 TCAGAGCCTGCAATGTAGAGGGG + Intronic
965199965 3:165645466-165645488 TCAGAGCAAGCGAGAGAGCAGGG - Intergenic
965450616 3:168833554-168833576 AGAGAGCCAGCAAGGAAGATAGG + Intergenic
965689190 3:171337280-171337302 TAAGAGCCTCCAAGTGAGAATGG + Intronic
965721716 3:171669150-171669172 ACACAGCCAGCCAGGGAGAGGGG - Intronic
965839511 3:172887452-172887474 TCAGGGCCTGCAAGGGTCAAGGG + Intergenic
965911917 3:173788888-173788910 TCATAGCCAGTAAGAAAGAAAGG + Intronic
966596275 3:181726881-181726903 ACGGTGGCAGCAAGGGAGAAAGG + Intergenic
968633883 4:1667787-1667809 TCAGAGCCAGCAGGGGTGCTTGG - Intronic
968687296 4:1969843-1969865 TCAGAGATAGCCAGGCAGAAAGG + Intronic
969020712 4:4138283-4138305 TAAGAGCCAGCGGGGGAGAGGGG + Intergenic
969089825 4:4685402-4685424 GAACAGCCAGCATGGGAGAAAGG + Intergenic
969369445 4:6722108-6722130 TAAGAGCCAGCAAGATGGAAGGG + Intergenic
969647758 4:8442703-8442725 TGACAGCCAGCAAGGGAACAAGG - Intronic
969792722 4:9503210-9503232 TAAGAGCCAGCGGGGGAGAAGGG - Intergenic
969905075 4:10386306-10386328 CCAGAGGCATCAAGAGAGAAAGG - Intergenic
970176662 4:13346344-13346366 ACAGAGGGAGCAAGAGAGAAAGG - Intergenic
970411210 4:15809520-15809542 TCAGACCCACCAAGTGAGAATGG - Intronic
970927193 4:21466603-21466625 TGAGAGACAGCAAGAGAGAGAGG + Intronic
971420217 4:26467682-26467704 TCAGAGTCAGAGAGGGAGATGGG + Intergenic
971557069 4:28026146-28026168 ACAAAGACAGCAATGGAGAAAGG + Intergenic
971835941 4:31762777-31762799 TCAGAGTCAGAAAAGGAGATAGG - Intergenic
972744456 4:41919987-41920009 ACAGAGCAAGCAAGAAAGAAAGG + Intergenic
972846655 4:42999563-42999585 CCAAAGACAGCAAAGGAGAATGG - Intronic
973641719 4:52909562-52909584 GCGGACCAAGCAAGGGAGAAAGG + Intronic
973960210 4:56102358-56102380 TCAGAGCCAGCATGGATGAGTGG + Intergenic
974713953 4:65641227-65641249 TCAGAGCTAGAGAGGCAGAAAGG + Intronic
974924749 4:68283206-68283228 TCAGAGGCAGTAGGGGAGATAGG + Intergenic
975758885 4:77598409-77598431 TCAGAGCCTGGAAGAGGGAAGGG + Intronic
975998297 4:80341250-80341272 CCAGAGCCAGCAAGCTAGAAAGG - Intronic
976117890 4:81747740-81747762 TCACAGCCAGCAAGTGAGCATGG + Intronic
976416916 4:84787240-84787262 TCAGAGCCAGTAAGAGAAACTGG + Intronic
976572990 4:86635009-86635031 TCAGAGACAGAACTGGAGAATGG - Intronic
977039832 4:92002223-92002245 TTAGAGCCAGCAGGGCAGGAAGG - Intergenic
977723306 4:100266215-100266237 TCAGATTCACCAAGGTAGAAAGG - Intergenic
978227343 4:106353062-106353084 TGAGGGTCATCAAGGGAGAAGGG + Intergenic
978235104 4:106448189-106448211 CCAGATACAGCAAGTGAGAAAGG + Intergenic
978385006 4:108169374-108169396 CCAGAGCCAGGGAGGGAGAGTGG - Intergenic
981282285 4:142972168-142972190 TAAGAGGAAGGAAGGGAGAAAGG + Intergenic
981701361 4:147610520-147610542 TCAAAGCCAGCAACAGAGAGTGG - Intergenic
981806327 4:148719644-148719666 TCATGCCCTGCAAGGGAGAAGGG + Intergenic
982395987 4:154916224-154916246 TCAGAGACAGGAAGGGAGTAAGG + Intergenic
982431285 4:155324605-155324627 TCAGAGCCAACACTGGAGTATGG - Intergenic
982634409 4:157874759-157874781 TCAGAGCCAGCCAAGAAGACAGG + Intergenic
982686718 4:158499271-158499293 TAAGAGCCAAGAAAGGAGAAAGG + Intronic
983492070 4:168399683-168399705 GCAGAGCCAGTAAGTGAGGATGG + Intronic
983565620 4:169148279-169148301 ACAGAGCCAGGAATCGAGAAAGG - Intronic
984018657 4:174457256-174457278 TCTGAGACAGAAAGAGAGAAAGG - Intergenic
984330304 4:178306856-178306878 TCACAGCCAGCAAGGAAACAGGG - Intergenic
984701365 4:182820689-182820711 CGAGAACCAGCAAGGGAGACTGG - Intergenic
984918549 4:184744214-184744236 TCACAGCCAGCACGAGGGAAAGG + Intergenic
985236476 4:187880787-187880809 TCTGAGCCAGCATGGGAGAGCGG + Intergenic
1202763354 4_GL000008v2_random:131349-131371 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
985877429 5:2610415-2610437 TCAGACCCAACCAGTGAGAATGG - Intergenic
986599689 5:9459378-9459400 CAAAAGCCAGCCAGGGAGAAAGG - Intronic
986753548 5:10812316-10812338 CCAGAGCCAGCAGGCTAGAATGG - Intergenic
987320903 5:16768412-16768434 TGAGTGCCAGCATGGTAGAATGG - Intronic
987644470 5:20650326-20650348 TTAAAGGCAGCTAGGGAGAAAGG + Intergenic
987763378 5:22193939-22193961 TTAGGGACTGCAAGGGAGAAAGG + Intronic
987855290 5:23412850-23412872 ACAGAGACAGCAGGGGACAAAGG + Intergenic
987985427 5:25140160-25140182 TCAAAACCAGCAATGGAGGATGG - Intergenic
988834533 5:35018306-35018328 TTAAAGGCAGCAAGAGAGAAAGG + Intronic
988936187 5:36084984-36085006 TTAAAGGCAGCTAGGGAGAAAGG + Intergenic
991030526 5:62077643-62077665 TGAGAGCAACCAGGGGAGAAGGG + Intergenic
991898094 5:71427025-71427047 TTAGGGACTGCAAGGGAGAAAGG + Intergenic
991949407 5:71933149-71933171 TCAGAGGGAGCAAGCTAGAAGGG + Intergenic
992935630 5:81701206-81701228 TCAGAGACAGGAAGAGAGATGGG + Intronic
993151891 5:84172947-84172969 CCAGAGCCAGCAAAGGAGACAGG - Intronic
993187257 5:84635904-84635926 GCAGAGACAGCAGGGGAGATTGG + Intergenic
993448638 5:88046195-88046217 TAAGAACCATCAAGGGAAAAGGG + Intergenic
994535800 5:101027523-101027545 TTAGAGGCAGCTAGAGAGAAGGG + Intergenic
994642916 5:102432681-102432703 TCAAAGGCAGCTAGAGAGAAAGG - Intronic
995023159 5:107389140-107389162 TCAGAGCAACCAGGGGAGATAGG - Intronic
995203752 5:109455824-109455846 ACAGTGCCTGCCAGGGAGAAGGG + Intergenic
996036311 5:118762650-118762672 TCGGAGCCAGCAGGTGGGAAAGG - Intergenic
996249839 5:121316324-121316346 TTAAAGGCAGCTAGGGAGAAGGG - Intergenic
996463188 5:123770631-123770653 TCAGAGCCATCAGGTGGGAAAGG + Intergenic
996808899 5:127491366-127491388 GCACATCCAGCAAGTGAGAAGGG - Intergenic
997238131 5:132287130-132287152 TGAGAGCAGGAAAGGGAGAAAGG - Intronic
997645368 5:135478029-135478051 TCATGGCCTGCATGGGAGAAAGG - Intergenic
997713369 5:136024552-136024574 TCAAAGCCCGCAAGGGAGGCTGG - Intergenic
997729423 5:136156202-136156224 TCAAAGCCAGTAAGGAAGAGAGG + Intronic
998130673 5:139649708-139649730 GCAGAGCCTGGGAGGGAGAATGG + Intronic
998260847 5:140630864-140630886 TCACAGGGAGCATGGGAGAAAGG - Intergenic
998766464 5:145493251-145493273 ACATAGGCAGCGAGGGAGAAGGG - Intronic
999052979 5:148543915-148543937 TCAGAACAAGCCAGGGAGCATGG - Intronic
999180370 5:149665998-149666020 TGAGAGCCAGCAAGCCAGAGAGG - Intergenic
999193633 5:149767150-149767172 GCAAAGCCAGCAAGGGAAATGGG - Intronic
1000249551 5:159481068-159481090 TCAGTGGCAGAAAGGAAGAAAGG + Intergenic
1000288597 5:159848848-159848870 TCAGAGCCAGAAAGCAAGACAGG - Intergenic
1000849233 5:166319541-166319563 TCAGAGCCGGCTGGGGTGAATGG + Intergenic
1001036982 5:168303972-168303994 ACAGAACCAGCAAGTGACAAAGG - Intronic
1001595540 5:172896496-172896518 TCAGAACCAGAGAGGCAGAAGGG + Intronic
1001785696 5:174410989-174411011 ACAGATCCAGCAAGCGAGATGGG - Intergenic
1002198232 5:177512670-177512692 TCAGAGCCACCATGGGACAGGGG + Intronic
1002300914 5:178256910-178256932 TCAGGGCGAGCCAGGGAGCATGG - Exonic
1002357485 5:178642532-178642554 TCATAGGAAGCAAGGGACAACGG + Intergenic
1003437464 6:6105073-6105095 TTAAAGCCAGCTAGAGAGAAAGG - Intergenic
1003879070 6:10464004-10464026 TCCACACCAGCAAGGGAGAAGGG + Intergenic
1004246807 6:13985847-13985869 AGAGAGGAAGCAAGGGAGAAGGG - Intergenic
1004449246 6:15729565-15729587 TCTGAGCCAGCATGGTAGAGGGG - Intergenic
1005325061 6:24692138-24692160 TAAGAGCCAGCAAAGGAGACTGG + Intronic
1005915544 6:30347759-30347781 TCAAAGCTAGCGAGGGAGCAAGG - Intergenic
1006309668 6:33248974-33248996 TCAGCGCGAGGACGGGAGAAGGG - Intergenic
1006868614 6:37230039-37230061 TAACAGCCAGCAAGGAAGTAGGG - Intronic
1007245137 6:40456061-40456083 TGACAGCCTGCAAGAGAGAAGGG + Intronic
1007663122 6:43498646-43498668 TCAGAGCCCACAAAGGAGAGTGG + Intronic
1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG + Intronic
1008082685 6:47210299-47210321 CCAGAGCCAGCAGGCAAGAAAGG - Intergenic
1008535958 6:52506251-52506273 GCAGAGCCAGCCAGGGAAAGTGG - Intronic
1008594291 6:53025632-53025654 TCAAAACAAGCAAGGGAAAATGG + Intronic
1008717387 6:54305562-54305584 TCAGAGTCTGGAAGGAAGAAAGG + Intergenic
1008751135 6:54735664-54735686 TTAAAGGCAGCAAGAGAGAAGGG - Intergenic
1009659955 6:66598238-66598260 TTAGCCCCAGCATGGGAGAAAGG + Intergenic
1010450192 6:75993897-75993919 TCAGTGCCAGCAAGTGTGAAAGG + Intronic
1011032146 6:82935217-82935239 GCAGAGCAAGCAAGAGAGAGGGG + Intronic
1011137229 6:84113985-84114007 TTAAAGGCAGCAAGAGAGAAAGG - Intergenic
1011898520 6:92262280-92262302 AGAGAGGGAGCAAGGGAGAAAGG - Intergenic
1012339615 6:98103906-98103928 TTAGAGGCAGCTAGAGAGAAAGG - Intergenic
1013678520 6:112494781-112494803 TCAGAGCCAGAAAGGAACAGAGG + Intergenic
1014524877 6:122490593-122490615 TGAGAGCAAGAAAGAGAGAAGGG - Intronic
1015199736 6:130565760-130565782 TCAGAGACATCAGGGCAGAAAGG + Intergenic
1015797002 6:137023179-137023201 TCAGACTAAGCAAGGGAGTAAGG + Intronic
1015907943 6:138136739-138136761 TAAGGGCCAGAAAAGGAGAAAGG + Intergenic
1016223230 6:141702175-141702197 CCAAAGCCAGCAAGGGAGTGAGG + Intergenic
1016379052 6:143454757-143454779 GTAGAGCTAGCAAAGGAGAAAGG + Intronic
1016995375 6:149958858-149958880 TCAGAGCCAGCAACAGTGCATGG + Intergenic
1017012847 6:150074684-150074706 TCAGAGCCAGCAACAGTGCATGG - Intergenic
1017566262 6:155690923-155690945 CCAGAACCAGGAAGGGACAAGGG + Intergenic
1017647402 6:156551744-156551766 TCACAGCCAGCAAGGCAGTGGGG + Intergenic
1017652953 6:156599667-156599689 GAAGAGCCAGGAAGGGTGAAAGG + Intergenic
1018185835 6:161264777-161264799 TGAGAGCCTGAAAGCGAGAAGGG + Intronic
1018705608 6:166461475-166461497 TGAGAGCAAGCGAGGGAGAGAGG + Intronic
1018783666 6:167091753-167091775 TCAGAGCCAGGAAGGGAGTTGGG + Intergenic
1019609417 7:1929425-1929447 TCAGAGCCAGCACGGGAGGCCGG + Intronic
1020645512 7:10810312-10810334 TTAGGGGCAGCCAGGGAGAAAGG - Intergenic
1021512654 7:21451303-21451325 TCACAGCCAGCAACAGGGAAAGG - Intronic
1021598154 7:22338929-22338951 TCAGAGCCAGCACCAGGGAAAGG + Intronic
1022184255 7:27951853-27951875 ACAGAGGCAGCAAAGGAGAGAGG - Intronic
1022467950 7:30663881-30663903 TCAGAGCCAGACAGAGAGGATGG - Intronic
1023086421 7:36573895-36573917 TCAGAACCAGCAAGAGAGAAAGG - Intronic
1023472254 7:40536341-40536363 TCTGAGACAGGCAGGGAGAAGGG + Intronic
1023839385 7:44087938-44087960 TCAGAGCCAGGAGGGGAGGCCGG - Intergenic
1023929661 7:44697588-44697610 TCAAAGCCTACAAGGGACAAAGG - Exonic
1024427082 7:49238790-49238812 TCAGAGGCAGCTAGAGAGAAAGG - Intergenic
1024652739 7:51419921-51419943 TCAGAGGCAGGAAAGGGGAAAGG - Intergenic
1024965955 7:55022008-55022030 TCAGAGCTGGCAAGGGGAAAGGG + Intronic
1025079137 7:55967014-55967036 TCAGTTTCAGCAAGGGAGAAGGG + Intronic
1026239542 7:68560618-68560640 TCAGAACCAGCAACGGCGACTGG + Intergenic
1027299559 7:76816850-76816872 CCAAAGTCAGCTAGGGAGAAGGG - Intergenic
1027400875 7:77805265-77805287 TCAGAGTCAGAAAGAGAGAGAGG - Intronic
1027672734 7:81121612-81121634 TCAGAGCCAGAAACTGAGAAGGG - Intergenic
1027798516 7:82723108-82723130 TCAAAGGCAGCAAGGCAGAGTGG - Intergenic
1028715358 7:93959783-93959805 TCAAAGCCAGCAAAGGAGATGGG + Intergenic
1028858040 7:95614267-95614289 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1029078938 7:97957077-97957099 TAAGAGCCAGGAGGGGAGAGGGG + Intergenic
1029204437 7:98860457-98860479 TCAGAGCTAGGCAGGGAGAGGGG + Intronic
1032533601 7:132642474-132642496 TAGGAGTCAGCCAGGGAGAAGGG + Intronic
1033490948 7:141842881-141842903 TTAGAGCAGGAAAGGGAGAAAGG + Intergenic
1033861550 7:145634113-145634135 TCAGAGACAGATGGGGAGAAGGG + Intergenic
1034290019 7:149923001-149923023 TCAGATGCTGAAAGGGAGAAAGG + Intergenic
1034634093 7:152553767-152553789 TAATTGCCAGCACGGGAGAACGG + Intergenic
1034920120 7:155072638-155072660 TCAGAGCCAACAACAGAAAATGG - Intronic
1035043502 7:155948403-155948425 CCTGAGCCAGCAAGGGACCATGG + Intergenic
1035389354 7:158495435-158495457 TCTGAGAATGCAAGGGAGAAGGG - Intronic
1035887560 8:3308497-3308519 TCAAAACCTGCAAGAGAGAAAGG + Exonic
1035983747 8:4402367-4402389 TCAGAGCCAGAGAGGAACAAGGG - Intronic
1036680776 8:10871714-10871736 TCAGAGCCAGTATGGGAATAGGG - Intergenic
1037036645 8:14177286-14177308 TGAGAGCAGGGAAGGGAGAAAGG + Intronic
1038128432 8:24700831-24700853 CCACAGACAGCAAGGGAGCATGG - Intergenic
1039016725 8:33157649-33157671 GCAAAGCCAGCAGTGGAGAATGG + Intergenic
1039046262 8:33453177-33453199 CCACAGCAAACAAGGGAGAAAGG + Intronic
1040064097 8:43130466-43130488 TTGGAGCCAGCAAAGGGGAAAGG - Intergenic
1040067728 8:43161854-43161876 TCAGGGCCAGAGAGGGGGAAGGG - Intronic
1040091994 8:43408321-43408343 GGAGAGCCAGCAAGGAGGAATGG + Intergenic
1041012046 8:53553986-53554008 TCAGAGCCAGCAAGGAAGAGGGG - Intergenic
1041337243 8:56800253-56800275 TCAGAGTCAGCCAGGCAGAGAGG + Intergenic
1041689276 8:60673343-60673365 TCAGAACAAGCAGGGGAGGAGGG - Intergenic
1041925310 8:63230143-63230165 TTGAAGCCAGCAAGGGAGAGAGG + Intergenic
1042013327 8:64275915-64275937 TCAGAGGAAGGAAGGAAGAAGGG + Intergenic
1042489705 8:69382894-69382916 TCAAAGGCAGCCAGAGAGAAAGG + Intergenic
1042752064 8:72169086-72169108 TCAAAGGCAGCTAGAGAGAAAGG - Intergenic
1042976537 8:74476690-74476712 TTAAAGGCAGCAAGAGAGAAAGG - Intronic
1043085006 8:75819121-75819143 TGACAGCCAGCAAGGAAAAAGGG - Intergenic
1043529331 8:81132636-81132658 TCAGTACCAGCAAGACAGAAGGG - Intergenic
1044185961 8:89252536-89252558 TTAGAGGCAGCTAGAGAGAAAGG - Intergenic
1044486428 8:92759793-92759815 TCAGACCCAGGAAGTGAAAAGGG + Intergenic
1045662758 8:104455189-104455211 TCATAGCCAGCAAGGAGCAATGG + Intronic
1045676174 8:104610149-104610171 TAAAAGCAAGCAATGGAGAAAGG - Intronic
1045676411 8:104613103-104613125 TTAGAGCCAGCTAGAGAGAAGGG - Intronic
1046349779 8:112992707-112992729 TCTAAGTCAGCAATGGAGAAGGG + Intronic
1047194602 8:122710127-122710149 TCAGAGTCAGAAAAGGAGATTGG - Intergenic
1047377647 8:124317800-124317822 TCAGAGCCAGCAAGGGAGAAAGG - Intronic
1047652744 8:126941308-126941330 CCAGAGTGAGCAATGGAGAATGG - Intergenic
1048195395 8:132328011-132328033 CCAGAGCCAGCATGGGGGCATGG + Intronic
1049219026 8:141420475-141420497 TGAGACCCAGAAAGGGAGAGAGG + Intronic
1050158311 9:2691270-2691292 TCAACGGCAGCAAGGGAGAAGGG + Intergenic
1050238030 9:3603579-3603601 GCAGAGTAAGCAAGGGAGACAGG + Intergenic
1050262955 9:3860420-3860442 GCTGAGCAAGCAATGGAGAAGGG - Intronic
1050282904 9:4070559-4070581 GCAGAGCAAGCGAGAGAGAAAGG + Intronic
1050740178 9:8810894-8810916 TCATAGCCAACAAGGGAAAGGGG - Intronic
1051068606 9:13135482-13135504 TCAGAGGTAGCAGGGGAGAGAGG - Intronic
1052395528 9:27933776-27933798 TCAGAGACAGATAGGCAGAACGG - Intergenic
1053531003 9:38880765-38880787 TTAAAGGCAGCTAGGGAGAAAGG + Intergenic
1053736289 9:41104870-41104892 TCAGAGCCAGCGGGGGAAGAGGG - Intergenic
1054203227 9:62105197-62105219 TTAAAGGCAGCTAGGGAGAAAGG + Intergenic
1054635135 9:67483167-67483189 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
1054692084 9:68326530-68326552 TCAGAGCCAGCGGGGGAAGAGGG + Intergenic
1054770234 9:69076809-69076831 TACATGCCAGCAAGGGAGAAAGG + Intronic
1055369558 9:75582543-75582565 TGAGAGAAAGCAAGAGAGAAGGG - Intergenic
1055859380 9:80730244-80730266 TCAGAGCCAGTAAGGCATAGTGG + Intergenic
1056115496 9:83437514-83437536 TCAGAGCAAGACAGGGAGATAGG - Intronic
1057019226 9:91683045-91683067 TCAAAGCCAGCCAGGGAGAGAGG + Intronic
1057181866 9:93034881-93034903 CCAGAGCCAGCCAGGGTGCAAGG + Intronic
1057271666 9:93654969-93654991 TCAGAGCCAGCGAGGGAGGAGGG + Intronic
1057522609 9:95772119-95772141 TCAGGGCCAGGAAGGCAGGAGGG + Intergenic
1058522323 9:105823123-105823145 TAACAGCCAGCAGGGGAGAGGGG - Intergenic
1059378204 9:113902171-113902193 TCAGAGCCACACAGGGAGGAAGG - Intronic
1060148737 9:121272988-121273010 GCAGAGCAAGCAAGGGAGGAGGG - Intronic
1060788783 9:126471381-126471403 TGAGAGGCAGCACGGGAGGACGG - Intronic
1060958874 9:127664770-127664792 TCAGACCCAGCCATGGGGAAGGG + Intronic
1061218858 9:129237307-129237329 TCAGAGAGAGGAAGGGAGGAAGG + Intergenic
1061602408 9:131679851-131679873 TCAAAGCTAGCCAGGAAGAATGG + Intronic
1061626453 9:131843313-131843335 TCAGAGCCAGCATGAGAGGGTGG + Intergenic
1061888425 9:133605111-133605133 GCAGAGCCAGGAAGTGAGCACGG + Intergenic
1061953669 9:133950410-133950432 TCAGAGCCAGCAGCTGAGAGAGG + Intronic
1062095173 9:134699425-134699447 GCAGAGAGAGGAAGGGAGAAGGG - Intronic
1062209768 9:135357175-135357197 TCAGAGCCAGCCAGGGACAGGGG + Intergenic
1062285327 9:135770226-135770248 GCAGACCCAGCCGGGGAGAAGGG + Intronic
1062328519 9:136024598-136024620 TGAGGACCAGCAGGGGAGAATGG + Intronic
1062393794 9:136344490-136344512 GCAGAGACAGCGAGGAAGAAGGG + Intronic
1062581600 9:137231396-137231418 TCAGGACCAGCAAGGGAGCCGGG + Intronic
1203527588 Un_GL000213v1:104243-104265 TTAAAGGCAGCTAGGGAGAAAGG - Intergenic
1185487566 X:494726-494748 TCAAAGCCTGCAAGGAAAAAAGG + Intergenic
1186957616 X:14700424-14700446 TCAGAGACAGGCAGGGGGAAAGG + Intronic
1187642947 X:21314644-21314666 TCATAGCCAGCAAGGCAATAGGG + Intergenic
1187751058 X:22465481-22465503 ACAGAGGAAGCAAGGAAGAAAGG - Intergenic
1187963393 X:24587270-24587292 TCAGAGCCAGCAGAGGAATACGG + Exonic
1188217918 X:27501777-27501799 TGAGAGGAAGCAAGGGGGAAGGG + Intergenic
1188848409 X:35102704-35102726 TCAAAGCCAATAAGGGATAAGGG - Intergenic
1190789021 X:53682750-53682772 TCAGAGCAAGGCAGGGAAAAGGG + Intronic
1191949736 X:66575629-66575651 TGAAAGCAAGCAATGGAGAAAGG - Intergenic
1192244234 X:69359824-69359846 GCAGAGACAGAAAGGGAGAAAGG - Intergenic
1193553947 X:82931332-82931354 TCAGGACTAGAAAGGGAGAAAGG - Intergenic
1193883655 X:86958939-86958961 TCAAAGGCAGCTAGAGAGAAAGG - Intergenic
1194159456 X:90432846-90432868 TCACAGCCAGCACCAGAGAAAGG - Intergenic
1194194752 X:90879097-90879119 TCAAAGCAAGCAATAGAGAAAGG - Intergenic
1194774556 X:97945976-97945998 TCAAAGGCAGCTAGAGAGAAGGG + Intergenic
1194867607 X:99087613-99087635 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1195149008 X:102046194-102046216 TTAAAGGCAGCAAGAGAGAAAGG + Intergenic
1195724853 X:107903897-107903919 TTAGAGCCAGCAGGGGACAAAGG + Intronic
1196348516 X:114698035-114698057 TGATAGCCAGCAAGGAAGCAGGG - Intronic
1196373229 X:115001755-115001777 TCATAGCCAGCACCGGGGAAAGG - Intergenic
1196891054 X:120291375-120291397 CCAGAGGCAGCAAGTGCGAAAGG - Intronic
1197175579 X:123482327-123482349 ACAGGGAGAGCAAGGGAGAAAGG + Intronic
1197297853 X:124740914-124740936 CCAGAGAGAGGAAGGGAGAAGGG + Intronic
1197466987 X:126816972-126816994 TGAGAGACAGCAAGGAAGAGAGG - Intergenic
1197482651 X:127006089-127006111 TCAAAGGCAGCTAGAGAGAAAGG + Intergenic
1197866386 X:131023173-131023195 TCAGAGTCATCAAAGGAGGAGGG - Intergenic
1198005818 X:132491381-132491403 TCACAGTCAGCTAGAGAGAAGGG + Intergenic
1198175242 X:134148384-134148406 TCAGAACCAGCAATGGAGAGTGG - Intergenic
1198536809 X:137594656-137594678 TCAGAGCTGGAAAGGCAGAAAGG + Intergenic
1198768696 X:140105521-140105543 CCAGAGGCAGAAAGGGATAATGG - Intergenic
1198868096 X:141147039-141147061 TTAAAGCCAGCTAGAGAGAAGGG - Intergenic
1199479368 X:148281095-148281117 TCAGAGACAGGAAAGAAGAAAGG - Intergenic
1200316774 X:155141713-155141735 ACAGAGACAGTCAGGGAGAAGGG - Intronic
1200541370 Y:4461508-4461530 TCAAAGCAAGCAATAGAGAAAGG - Intergenic
1201219238 Y:11750666-11750688 TCAGAGCCAGCGAGGGAGAAAGG - Intergenic
1201534039 Y:15025737-15025759 TAAGATGCAGCAAGAGAGAAGGG - Intergenic