ID: 1047381723

View in Genome Browser
Species Human (GRCh38)
Location 8:124371574-124371596
Sequence GGCCGAAGCTCCGGATTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047381719_1047381723 1 Left 1047381719 8:124371550-124371572 CCAACAGCGTTAACTGGCATTTT 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1047381723 8:124371574-124371596 GGCCGAAGCTCCGGATTCGGAGG No data
1047381718_1047381723 2 Left 1047381718 8:124371549-124371571 CCCAACAGCGTTAACTGGCATTT 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1047381723 8:124371574-124371596 GGCCGAAGCTCCGGATTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047381723 Original CRISPR GGCCGAAGCTCCGGATTCGG AGG Intronic
No off target data available for this crispr