ID: 1047381969

View in Genome Browser
Species Human (GRCh38)
Location 8:124372415-124372437
Sequence CAGCGCCCGGAGAGGGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 491}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047381955_1047381969 19 Left 1047381955 8:124372373-124372395 CCTCCGATGGGAAAAACTTTCTC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG 0: 1
1: 0
2: 4
3: 34
4: 491
1047381954_1047381969 20 Left 1047381954 8:124372372-124372394 CCCTCCGATGGGAAAAACTTTCT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG 0: 1
1: 0
2: 4
3: 34
4: 491
1047381952_1047381969 24 Left 1047381952 8:124372368-124372390 CCGCCCCTCCGATGGGAAAAACT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG 0: 1
1: 0
2: 4
3: 34
4: 491
1047381953_1047381969 21 Left 1047381953 8:124372371-124372393 CCCCTCCGATGGGAAAAACTTTC 0: 1
1: 0
2: 0
3: 2
4: 86
Right 1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG 0: 1
1: 0
2: 4
3: 34
4: 491
1047381951_1047381969 25 Left 1047381951 8:124372367-124372389 CCCGCCCCTCCGATGGGAAAAAC 0: 1
1: 0
2: 1
3: 6
4: 89
Right 1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG 0: 1
1: 0
2: 4
3: 34
4: 491
1047381956_1047381969 16 Left 1047381956 8:124372376-124372398 CCGATGGGAAAAACTTTCTCTGA 0: 1
1: 0
2: 0
3: 17
4: 205
Right 1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG 0: 1
1: 0
2: 4
3: 34
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047381969 Original CRISPR CAGCGCCCGGAGAGGGCGGG CGG Exonic
900113646 1:1019867-1019889 CAGCGCCCGGCGCGGCCGTGGGG - Intergenic
900155114 1:1200823-1200845 CAGCGCCAGGACAGGTGGGGAGG - Intergenic
900393452 1:2443682-2443704 CCGCGCCGGGAGGGGGCCGGGGG - Intronic
900512743 1:3068232-3068254 CGGCGGCAGGAGAGCGCGGGCGG + Intergenic
901109916 1:6785815-6785837 CTGGGGCCGGAGGGGGCGGGGGG + Intronic
901110037 1:6786149-6786171 CACCTCCCTGAGCGGGCGGGGGG + Intronic
901726998 1:11250140-11250162 CACCTCCCGGACAGGGCGGCTGG + Intronic
901784251 1:11614124-11614146 CAGCGTCAGGAGAGGGCAGGGGG - Intergenic
901865847 1:12106272-12106294 CAGCACGTGCAGAGGGCGGGTGG - Intronic
901886938 1:12230082-12230104 CAGCGCCGGGCTGGGGCGGGCGG + Exonic
902348357 1:15835556-15835578 CAGCACGGGGAGAGGGCAGGGGG - Intergenic
902686416 1:18080489-18080511 CAGCCCCCGGAGAAGGCAGGGGG - Intergenic
902772277 1:18652167-18652189 CAGAGCCGGTAGAGGGTGGGAGG + Intronic
903103519 1:21053616-21053638 CACCTCCCGGACGGGGCGGGTGG - Intronic
903224854 1:21888689-21888711 CAGCGGCCGGCGGGGGTGGGGGG + Intronic
903588776 1:24438459-24438481 CAGGGACGGGAGAGGGCAGGAGG - Intronic
903962247 1:27064525-27064547 CACCTCCCGGACAGGGCGGCTGG - Intergenic
903986885 1:27234968-27234990 CGGCGCCCGCGGAGGGCAGGGGG - Intronic
904181374 1:28668912-28668934 CGGCGGCCGGCGAGGGCGGGCGG + Intronic
904532154 1:31176759-31176781 CACCTCCCGGACAGGGCGGCTGG - Intergenic
904719933 1:32500412-32500434 CAGCGCGGGCAGAGGGCGAGAGG + Intronic
904724854 1:32539588-32539610 CGGCGCCGGCGGAGGGCGGGCGG + Intronic
904795341 1:33052687-33052709 CACCTCCCGGACAGGGCGGCTGG - Intronic
905174031 1:36125210-36125232 CGGCTGCCGGAGTGGGCGGGCGG + Exonic
905342784 1:37290693-37290715 CAGAGCCCGGGGTGGGCAGGGGG - Intergenic
905416700 1:37808706-37808728 CGGCGCCCGGAGCCGGCTGGTGG + Exonic
905427553 1:37896801-37896823 CACCTCCCGGACAGGGCGGCTGG - Intronic
905427679 1:37897133-37897155 CACCTCCCGGACAGGGCGGCTGG - Intronic
905617052 1:39408738-39408760 CCGCCCCCGGAGAGGGCGCAAGG - Intronic
905684998 1:39901702-39901724 CAGGGCCCGGCGGGGCCGGGCGG + Intronic
905803691 1:40861577-40861599 CAGCTCACGGAGCCGGCGGGCGG + Exonic
906036009 1:42750715-42750737 CACCTCCCGGACAGGGCGGCCGG - Intronic
906141307 1:43535365-43535387 CAGGGCCCAGGGAGGGTGGGAGG - Intronic
906487200 1:46241929-46241951 CACCTCCCGGACAGGGCGGCTGG - Intergenic
906495781 1:46303052-46303074 CAGCGGCCGGGGGGCGCGGGGGG - Intronic
906639601 1:47433722-47433744 CAGCGCCTGAAGTGGGCAGGTGG + Intergenic
906641970 1:47446327-47446349 CAGGGGCCGGAGAGGTCGTGTGG - Intergenic
906645809 1:47473805-47473827 CAGCGCCTAGGGTGGGCGGGAGG + Intergenic
907402625 1:54233786-54233808 CACCTCCCGGACAGGGCGGCTGG - Intronic
910288233 1:85577230-85577252 CGACGCGCGGAGAGGGCGGTCGG - Intronic
910694306 1:89995389-89995411 CTGGGCCCGGGGCGGGCGGGCGG - Intronic
911208618 1:95117551-95117573 CCGAGCCGGGAGAGGGCGGCGGG - Exonic
912658408 1:111507880-111507902 CAGAGCCCGGAGAGTGGTGGGGG - Intronic
912752052 1:112294158-112294180 CACCTCCCGGACAGGGCGGCTGG - Intergenic
912845173 1:113070164-113070186 CACCTCCCGGACAGGGCGGCTGG - Intergenic
913172168 1:116243004-116243026 CAGCTCCGGGGGAGGGCGGGAGG - Intergenic
914203397 1:145505955-145505977 GAGCCCACGGAGGGGGCGGGAGG + Intergenic
914231355 1:145766765-145766787 CACCTCCCGGACAGGGCGGCTGG + Intronic
914386288 1:147172689-147172711 CAGCGCCAGGAGGGGGCGCCAGG + Intergenic
914482519 1:148079109-148079131 GAGCCCACGGAGGGGGCGGGAGG + Intergenic
914858724 1:151370002-151370024 CAGGGCCCCGGGAGGGTGGGAGG + Intronic
914888213 1:151600874-151600896 CACCTCCCGGACAGGGCGGCTGG - Intergenic
915865515 1:159494693-159494715 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
917375541 1:174349016-174349038 CACCTCCCGGACAGGGCGGCTGG + Intronic
918255255 1:182741718-182741740 CACCTCCCGGACAGGGCGGCTGG + Intergenic
918284915 1:183042800-183042822 CAGTGCCAGGAGAGGGCTGGGGG - Intronic
920089184 1:203440342-203440364 CAGGGCCCAGAGAGGATGGGTGG - Intergenic
920260615 1:204685542-204685564 CAGGGCGCGGAGAGGGGGTGGGG - Intronic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
920924471 1:210328851-210328873 CATCGCCCGGAGAGCGCCGCGGG + Intronic
920944599 1:210516293-210516315 CAGCTGGTGGAGAGGGCGGGTGG + Intronic
921472711 1:215567674-215567696 GAGCCGCCGGAGATGGCGGGAGG + Exonic
921903797 1:220475754-220475776 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
921983635 1:221285743-221285765 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
922415563 1:225419227-225419249 CTGGGCCCAGAGAGGGCAGGTGG - Intronic
922503809 1:226115070-226115092 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
922727085 1:227927591-227927613 CAGAGCACGGCTAGGGCGGGAGG + Intronic
923137140 1:231128792-231128814 CACCTCCCGGACAGGGCGGCTGG - Intergenic
923161147 1:231316029-231316051 CAGAGCCCAGGGAGGGCTGGAGG + Intergenic
924052826 1:240093788-240093810 CAGAGCCCAGGGAGGGCGGGTGG - Intronic
924634778 1:245775194-245775216 CACCTCCCGGACAGGGCGGCTGG - Intronic
1063664968 10:8055593-8055615 CCGCGCGCGGGGAGGGAGGGCGG - Exonic
1063822713 10:9855713-9855735 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1064073516 10:12250369-12250391 CAGCTCCCGGAGCGGTGGGGCGG - Exonic
1064108420 10:12519585-12519607 CACCTCCCGGACAGGGCGGCTGG + Intronic
1065830394 10:29609350-29609372 CAGCACCAGCAGAGGGTGGGAGG - Intronic
1065840413 10:29696842-29696864 CACCTCCCGGACAGGGCGGTTGG - Intronic
1067576632 10:47412903-47412925 GAGCTCCTGGGGAGGGCGGGTGG - Intergenic
1068969788 10:62948197-62948219 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1069557780 10:69408869-69408891 CGGGGCCTGGAGGGGGCGGGGGG - Intronic
1069635850 10:69924429-69924451 CACCTCCCAGAGTGGGCGGGTGG - Intronic
1070112031 10:73495820-73495842 CAGCCCCGGGAGGGGGCGGCGGG + Exonic
1070135549 10:73690007-73690029 CACCTCCCGGACAGGGCGGCTGG - Intronic
1071616714 10:87081346-87081368 CACCTCCCGGACAGGGCGGCTGG - Intronic
1072116985 10:92376038-92376060 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1072117144 10:92376397-92376419 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1072149587 10:92674503-92674525 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1072453979 10:95560759-95560781 CATCCCCTGGAGAGGGCGGCGGG - Intronic
1072481098 10:95810090-95810112 CACCTCCCGGACAGGGCGGCCGG + Intronic
1072602198 10:96941154-96941176 CACCTCCCGGACAGGGCGGCTGG + Intronic
1072648550 10:97276354-97276376 CACCTCCCGGACAGGGCGGCTGG - Intronic
1072949852 10:99839329-99839351 CACCTCCCGGACAGGGCGGCTGG + Intronic
1073048872 10:100655305-100655327 CAGCGCCGGGAGAGGGGAGAGGG - Intergenic
1073386397 10:103129649-103129671 CACCTCCCGGACAGGGCGGCTGG - Intronic
1073386526 10:103129954-103129976 CACCTCCCGGACAGGGCGGCTGG - Intronic
1073450729 10:103607424-103607446 CACCTCCCGGACAGGGCGGCTGG - Intronic
1074979543 10:118608615-118608637 CAGTGCCAGGAGAGGATGGGAGG + Intergenic
1075112206 10:119596607-119596629 CAGTGTCCGGAGCGGGCTGGGGG - Intronic
1075430398 10:122375122-122375144 CGGCGCCCGGCGGGGGAGGGCGG + Intronic
1076721939 10:132396770-132396792 CTGGGCCCGGAGGGGGAGGGGGG + Intergenic
1077077055 11:706621-706643 CTGCGTCCGGAGAGCGCTGGTGG + Intronic
1077223523 11:1427626-1427648 CAGGGCCCTGAGGGGGCAGGCGG - Intronic
1077285756 11:1764475-1764497 CAGCGCCCAGAGGGAGAGGGCGG - Intergenic
1078594347 11:12674173-12674195 CCGCGCCGGGAGACGGAGGGCGG + Intergenic
1080836269 11:35943970-35943992 CCGGGCCCGGGGAAGGCGGGAGG + Intronic
1083727897 11:64637858-64637880 CTGTGCCCAGAGAGGGCGGGAGG + Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083759330 11:64807133-64807155 CTGCGCCTGGTGAGGCCGGGGGG - Intronic
1084184588 11:67464870-67464892 CAGAGCCCGGTCAGGGCGAGGGG + Intronic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084745473 11:71167379-71167401 CACCTCCCGGACAGGGCGGCTGG + Intronic
1086366362 11:86111398-86111420 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1088462164 11:110093302-110093324 CGGCCCGCGGAGAGGGCGCGCGG + Intergenic
1088764736 11:112963513-112963535 CAGGGCCCGGAGAGGAGGGGTGG + Intronic
1089604825 11:119635752-119635774 CAGAGCCCGGGGAGGGAAGGCGG + Intronic
1089729589 11:120511913-120511935 CAGCGCAGGGAGCGGGCCGGGGG - Intronic
1090323248 11:125863762-125863784 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1090610716 11:128467956-128467978 CAGCCGCCTGAGAGGGAGGGTGG - Intronic
1090628679 11:128627521-128627543 CAGCGCCAGGTCAGGGTGGGCGG - Intergenic
1091225428 11:133954193-133954215 CAGCCTCTGGAGAGAGCGGGTGG - Intronic
1091699990 12:2652895-2652917 CAGCCCCAGGAGATGTCGGGGGG - Intronic
1091799533 12:3316220-3316242 CAGCACCCAGAGAGGGCAGCAGG + Intergenic
1092204864 12:6608525-6608547 CAGCGCCTGGAGATGGGGGTGGG - Intergenic
1092572382 12:9739661-9739683 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1096021973 12:48332428-48332450 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1096082449 12:48842295-48842317 CACCTCCCGGACAGGGCGGCTGG - Intronic
1096264347 12:50111510-50111532 CAGCTTGCGGCGAGGGCGGGAGG - Intergenic
1096396567 12:51270411-51270433 CAGAGGCCGGAGGGGGTGGGGGG + Exonic
1096999343 12:55863181-55863203 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1098884029 12:75942512-75942534 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1099255383 12:80307833-80307855 CACCTCCCGGACAGGGCGGCTGG + Intronic
1100507377 12:95235252-95235274 CACCTCCCGGACAGGGCGGCTGG + Intronic
1102293814 12:111722980-111723002 CACCTCCCGGACGGGGCGGGTGG + Intronic
1102925232 12:116821301-116821323 CAGCGCCCGGCCAGGAGGGGTGG - Intronic
1104580631 12:130008525-130008547 CAGCTGCCGGAAAGGGAGGGGGG + Intergenic
1104666327 12:130649810-130649832 CAGCCCCCGAAGAGGACGTGCGG + Intronic
1106560191 13:30839789-30839811 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1107133447 13:36920084-36920106 CGGCGCTCGGAGCGGGCGGCCGG - Intronic
1110792363 13:79600243-79600265 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1110922224 13:81102409-81102431 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1111960850 13:94808365-94808387 CAGCACTCTGGGAGGGCGGGCGG + Intergenic
1112183763 13:97109469-97109491 CACCGCCGGGGGTGGGCGGGGGG + Intergenic
1113656017 13:112068160-112068182 CAGCGCCTGGAGAGCCCAGGCGG + Exonic
1113707807 13:112445630-112445652 GAGAGCCCGGGGAGGGAGGGCGG - Intergenic
1113853155 13:113429325-113429347 CAGGGCCTGGGGAGGGCGGTGGG - Intronic
1114199496 14:20507013-20507035 CACCTCCCGGACAGGGCGGCTGG - Intronic
1114422778 14:22598445-22598467 CGGCCTCCGGGGAGGGCGGGGGG + Intronic
1115609884 14:35039479-35039501 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1116480682 14:45389973-45389995 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1116886994 14:50231492-50231514 CAGCGCCCGCAGAGGAAGCGCGG + Exonic
1117141110 14:52791688-52791710 CGGGGCCCGGAGAGCGGGGGCGG + Intergenic
1117186753 14:53247542-53247564 CAGGGCCAGGGGAGGGCAGGGGG - Intergenic
1119798030 14:77416797-77416819 CACCTCCCGGACAGGGCGGCTGG + Intronic
1119835785 14:77747772-77747794 CACCTCCCGGACAGGGCGGCTGG - Intronic
1120309762 14:82814214-82814236 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
1121127652 14:91418082-91418104 CTGCGCTCGGCGAGGGCGCGCGG - Intergenic
1121368685 14:93337542-93337564 CAGCACCTGCAGAGGGCAGGAGG - Intronic
1122558188 14:102592612-102592634 CAGCGAGCGGAGAGGGGAGGAGG - Intergenic
1122628617 14:103097353-103097375 CAGTGCCCGGAGAGTCCAGGGGG - Intergenic
1122637896 14:103138794-103138816 CAGCGCGGGGACAGGGCGGGCGG + Intergenic
1122940336 14:104978298-104978320 CGGCGCACGGGGCGGGCGGGCGG + Exonic
1123197054 14:106627147-106627169 CAGCGCCAGCAGGGGGCGCGCGG - Intergenic
1124120385 15:26883560-26883582 GAGCGCCGGGCGGGGGCGGGCGG + Intronic
1124232135 15:27954858-27954880 CAGGGCCAGGAGCGGGCTGGTGG + Intronic
1126436662 15:48644902-48644924 CAGCGCCTGGAGAAGGCGGGAGG - Exonic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128322032 15:66701163-66701185 CCGCGCCCGGGGGGGGAGGGGGG + Intergenic
1128370064 15:67033893-67033915 CGGCGCACGGGGTGGGCGGGCGG - Intergenic
1128597411 15:68964573-68964595 CACCTCCCGGACAGGGCGGCTGG + Intronic
1129428596 15:75481727-75481749 CACCTCCCGGACAGGGCGGCTGG - Intronic
1129823755 15:78621001-78621023 CTGCGCCAGGCGCGGGCGGGCGG + Exonic
1131125502 15:89854595-89854617 CACCTCCCGGACAGGGCGGCTGG - Intronic
1131250242 15:90825592-90825614 CAGCACTCGGAGAGGCCGGCCGG + Intergenic
1131431976 15:92394780-92394802 CAAAGCCAGGCGAGGGCGGGGGG - Intronic
1132244012 15:100280565-100280587 CAGGGCCTGGTGAGGGAGGGCGG - Intronic
1132514522 16:359995-360017 CAGCGCCCGGAGAGGCGTGTGGG - Intergenic
1132679678 16:1134569-1134591 TGGCCCCCGGAGAGGGCTGGGGG - Intergenic
1132870098 16:2112114-2112136 CCAGGCCCGGGGAGGGCGGGGGG + Intronic
1132931384 16:2460705-2460727 CAGCACCTGGAGAAGGCGGGTGG - Intronic
1133038358 16:3046816-3046838 CCGGGCCTGGAGAGGGCGGGGGG - Exonic
1134134101 16:11668462-11668484 CGGCGGCCGGACCGGGCGGGCGG + Exonic
1135775976 16:25257819-25257841 CGGCCCGCGGAGAGCGCGGGGGG + Exonic
1136165284 16:28448966-28448988 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1136197690 16:28666054-28666076 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1136214028 16:28780191-28780213 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1136258763 16:29060115-29060137 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1136365011 16:29805981-29806003 CTACGCGCGGGGAGGGCGGGCGG - Intergenic
1136517158 16:30775067-30775089 CAGTGCCCGGAGAGGCCAGAGGG + Exonic
1136683713 16:31982208-31982230 CGGCGGCCACAGAGGGCGGGCGG + Intergenic
1136784342 16:32925764-32925786 CGGCGGCCACAGAGGGCGGGCGG + Intergenic
1136885443 16:33928042-33928064 CGGCGGCCACAGAGGGCGGGCGG - Intergenic
1137036812 16:35575160-35575182 CAGGGCCCGGCGCCGGCGGGTGG + Intergenic
1137283907 16:47000350-47000372 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1138179261 16:54931125-54931147 CGGCGCCCTGCGAGGGCGAGCGG - Exonic
1138426014 16:56932429-56932451 CATCCCCAGCAGAGGGCGGGGGG - Intronic
1138642558 16:58396982-58397004 CACCTCCAGGAGAGGGCGGCTGG + Intronic
1139475236 16:67199610-67199632 CAGGGCCTGCGGAGGGCGGGAGG + Intronic
1139546854 16:67653540-67653562 CAGCCCCGGGGGAGGGAGGGAGG - Intronic
1140020146 16:71230671-71230693 CGGCGCATGGAGAGTGCGGGCGG - Exonic
1140221620 16:73048156-73048178 CACCGCCCGGGGAAGGGGGGCGG + Exonic
1140436375 16:74950495-74950517 CAGCACCCAGAGAGGGCCAGAGG + Intronic
1141206607 16:81937936-81937958 CAGCCCCCAGGGAGGGCGGCTGG - Intronic
1141651575 16:85395798-85395820 CAGAGCCTGGGGAGGGTGGGCGG - Intergenic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1142173395 16:88634316-88634338 CAGCGCCCTGAGCGGGCCTGCGG - Intergenic
1203086999 16_KI270728v1_random:1189770-1189792 CGGCGGCCACAGAGGGCGGGCGG + Intergenic
1142671068 17:1487570-1487592 CAGAGGCGGGGGAGGGCGGGAGG + Intronic
1142815362 17:2420780-2420802 CTGCGCTCGGAGACGGCGGAAGG - Exonic
1143103174 17:4515035-4515057 CAGCCCAGGGAGGGGGCGGGAGG + Intronic
1147188275 17:38724677-38724699 CAGCGCCTGCAGATGGCTGGGGG + Exonic
1147422817 17:40331079-40331101 CAGCTCCAGGACAGGGCGGGTGG + Exonic
1147598860 17:41733842-41733864 CAGTGCCAGGAGAGGGGCGGGGG - Intronic
1147752426 17:42744669-42744691 CAGCGCCCAAAGGGCGCGGGAGG - Intronic
1148299513 17:46534791-46534813 CACCTCCCGGAGGGGGCGGCTGG + Intronic
1148698655 17:49575740-49575762 CAGCGCGGGGAGCGGGCGGCCGG + Intergenic
1149625050 17:58074305-58074327 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
1149950208 17:60977116-60977138 CACCTCCCGGACAGGGCGGCTGG + Intronic
1150214070 17:63456951-63456973 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1150527379 17:65937640-65937662 CACCTCCCGGACAGGGCGGCTGG - Intronic
1151615177 17:75205428-75205450 AGGCCCCCGGAGACGGCGGGAGG - Intergenic
1151933380 17:77247137-77247159 CGGCGCCCGGGGCGGGAGGGAGG - Intergenic
1151933468 17:77247464-77247486 CATCGCCCGGAGGAGGAGGGAGG - Intergenic
1152394492 17:80024024-80024046 CAGCCCTCGGCGAGTGCGGGCGG + Intronic
1152539939 17:80969772-80969794 CAGCCTCCAGACAGGGCGGGTGG + Intergenic
1152552095 17:81035019-81035041 CAGCGCCGGGCGGGGGCGGGTGG + Intergenic
1153480691 18:5543662-5543684 CGGCGGGCGGAGCGGGCGGGGGG + Intronic
1153900488 18:9614163-9614185 GAGCGGCCGGGGAGGGCGGGCGG - Intronic
1154005766 18:10526223-10526245 TAGCACCCGGGGGGGGCGGGAGG + Intronic
1154021569 18:10668169-10668191 GAGGGCCCAGAGTGGGCGGGGGG + Intronic
1154278385 18:12980336-12980358 CACCTCCCGGACAGGGCGGCTGG + Intronic
1155976804 18:32140098-32140120 GAGCCCACGGAGAGGGTGGGAGG - Intronic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158954478 18:62524813-62524835 CAGAGCCCGGAGACGGGAGGCGG - Intronic
1160028828 18:75241233-75241255 CAGAGTCCGGAGTGGGCTGGGGG + Intronic
1160204689 18:76822855-76822877 CAGCGCGCGGAGGGGCCGGGCGG - Intronic
1160707706 19:537139-537161 CATCATCCGGTGAGGGCGGGCGG + Exonic
1160734035 19:653682-653704 CAGCCCCTGGTGAGGCCGGGAGG - Intronic
1160792054 19:927498-927520 CAGGGCTCGGAGCGGGCTGGTGG + Intronic
1160846197 19:1167307-1167329 CTGGGCCCAGAGAGGGCGCGTGG - Intronic
1160937821 19:1605486-1605508 ACGCGCGCGGGGAGGGCGGGGGG + Exonic
1161088414 19:2345479-2345501 CAGCTCCCGGAGTGGCCAGGGGG - Intronic
1161400401 19:4064671-4064693 CTGCCTCCGGAGAGGGCGTGGGG - Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161582016 19:5086260-5086282 CAGGGCCCGGCCAGGGCAGGAGG - Intronic
1161709114 19:5837937-5837959 CAGAGCCCGGACTGGGAGGGAGG + Intronic
1162183942 19:8889868-8889890 TAGCACCAGGAGAGGGCTGGCGG + Exonic
1162733848 19:12734771-12734793 CAGCGCCCGCAGCGGGGGCGGGG + Exonic
1163012175 19:14433271-14433293 CGGCGCCCGGGGAGGGGGCGGGG - Intronic
1163625718 19:18388358-18388380 CAGAGCCCGGTGAAGGCGGGAGG - Exonic
1163831748 19:19550429-19550451 CAGGGCCCCGAGAGAGTGGGAGG - Intergenic
1163896448 19:20064435-20064457 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1164652734 19:29900148-29900170 CACCGCCCGGACGGGGCGGCTGG + Intergenic
1164652919 19:29900552-29900574 CACCGCCCGGACGGGGCGGCTGG + Intergenic
1164653069 19:29900905-29900927 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1164989676 19:32674971-32674993 CGGGGCCCGGAGAGTGAGGGGGG - Intronic
1165349867 19:35269513-35269535 CCGCGCCCGGGGAGGGCTGGGGG + Intronic
1165727576 19:38123859-38123881 CACCTCCCGGACAGGGCGGCTGG + Intronic
1165903405 19:39179148-39179170 CAGGGGCTGGAGAGGGTGGGGGG - Exonic
1166107302 19:40603772-40603794 CAGCCCCGGGAGAGAGAGGGAGG + Intronic
1166261693 19:41645032-41645054 CACCTCCCGGACAGGGCGGCTGG - Intronic
1166425687 19:42676387-42676409 CACCTCCCGGACAGGGCGGCTGG + Intronic
1166461734 19:42993663-42993685 CAGCGTCCGGAGAAGGGAGGTGG + Intronic
1167439424 19:49499914-49499936 CAGAGACCGGAGGGGGCGGGGGG - Intergenic
1167464913 19:49645599-49645621 CAGTGCTGGGAGAGGGCAGGAGG + Intronic
1167975521 19:53223042-53223064 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1168226516 19:54999108-54999130 CACCTCCCGGACAGGGCGGCTGG + Intronic
1168247046 19:55117606-55117628 CGGCCCCCGGGGCGGGCGGGCGG - Intergenic
1168307245 19:55442372-55442394 CAGGGCCCGGCCAGGCCGGGTGG - Exonic
1168696165 19:58405360-58405382 CATCTCCCGGACAGGGCGGCTGG + Intronic
925020889 2:567007-567029 CAACGCCCAGAGTGGGCAGGAGG + Intergenic
927931771 2:27050120-27050142 ACGCGCCAGGAGAGGGCGGCGGG - Intronic
928009434 2:27594206-27594228 CACCTCCCGGACAGGGCGGCCGG + Intronic
929151223 2:38750907-38750929 CAGCCGCCGCCGAGGGCGGGGGG + Intronic
929665637 2:43831898-43831920 AAGCCCCCGGGGCGGGCGGGGGG + Intronic
930136250 2:47906137-47906159 CAGCGGGGGGAGTGGGCGGGCGG + Intergenic
930651752 2:53970833-53970855 CGGAGCCCGGAGAGGGGTGGGGG - Exonic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932367316 2:71161355-71161377 CACCTCCCGGAGGGGGCGGCTGG - Intergenic
932624007 2:73284107-73284129 CTGCTCCCGGAGAGGGAAGGAGG - Intronic
933952341 2:87341858-87341880 CAGCACCCGGAGACGGGGGCTGG + Intergenic
934714622 2:96536631-96536653 CGTCGCGCGGAGAAGGCGGGGGG - Intergenic
934938803 2:98484480-98484502 CAGGGCCCTGAGAGGGTGTGAGG + Intronic
935331557 2:101981128-101981150 CAGCACCCCGAGATGGGGGGGGG + Intergenic
936518705 2:113198662-113198684 CAGCCACAGGAGGGGGCGGGAGG + Intronic
936546544 2:113395277-113395299 CACCTCCCGGACAGGGCGGCTGG - Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937221278 2:120344481-120344503 GAGCGCCCCGGGAGGGCCGGGGG + Intergenic
937221457 2:120345125-120345147 CAGGGCCGGGAGAGAGCGGGCGG - Intergenic
937284584 2:120741923-120741945 CCGCGCCCGGAGCGCGCGAGCGG + Intronic
937305395 2:120867575-120867597 CAGCGTGCGGGGAGGGCGGAGGG - Intronic
937987663 2:127645766-127645788 CTGCGCCCGCAGACGGCGGAGGG - Intronic
941023837 2:160438854-160438876 CACCTCCCGGACAGGGCGGCTGG + Intronic
941793196 2:169575105-169575127 CACCTCCCGGACAGGGCGGCTGG + Intergenic
942096257 2:172538158-172538180 CACCTCCCGGACGGGGCGGGTGG - Intergenic
942151073 2:173076174-173076196 CGGCGGCCGGAGCGAGCGGGCGG + Intronic
942450807 2:176107058-176107080 GAGCGCCCGGGGAGAGCTGGCGG + Intronic
943739788 2:191397914-191397936 CACCTCCCGGACAGGGCGGCTGG + Intronic
944255395 2:197619031-197619053 CACCTCCCGGACAGGGCGGCTGG - Intronic
944797991 2:203207311-203207333 CACCTCCCGGAGGGGGCGGCTGG - Intronic
944843114 2:203642953-203642975 GAGCCCACGGAGGGGGCGGGGGG + Intergenic
946318260 2:218931872-218931894 CACCTCCCGGACAGGGCGGCTGG - Intergenic
947549695 2:231037535-231037557 CGGCGGCCGCAGAGGGCGGGCGG + Exonic
948209229 2:236179769-236179791 CAGCGCCCGGCCGGGACGGGAGG - Intergenic
948645459 2:239401188-239401210 AGGCGCCCGGGGCGGGCGGGCGG - Intronic
948983927 2:241508651-241508673 CCGGGCCCGGAGTGGGCGGTGGG - Exonic
1169108655 20:3018819-3018841 CACCTCCCGGACAGGGCGGCTGG + Intronic
1170645780 20:18194775-18194797 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1171167707 20:22986547-22986569 CAGAGCCGGGGGAGGGCAGGGGG + Intergenic
1171971766 20:31569315-31569337 CAGCTCCAGGACAGGGCAGGGGG + Exonic
1172100803 20:32483285-32483307 CAGCAGCCGGAGAAGGGGGGCGG + Intronic
1172717518 20:36976322-36976344 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1172907363 20:38379204-38379226 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1173249008 20:41354766-41354788 CAGGGCCAGCACAGGGCGGGAGG + Intronic
1173470818 20:43322019-43322041 CAGTGCCCTGAGAGGGAGGGTGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174835856 20:53854620-53854642 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1175517494 20:59578341-59578363 CAGAGCCCGGAGTGGGGTGGAGG + Intronic
1175837280 20:62004164-62004186 CAGGGCCTGGAGGGGGCGGGTGG + Intronic
1176062603 20:63178896-63178918 AGGCGCCCGCAGAGGGCGGCGGG + Intergenic
1176666272 21:9690238-9690260 CAGCGCCAGGATTGGGCAGGAGG - Intergenic
1177496966 21:21902700-21902722 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1177565797 21:22818943-22818965 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1178075762 21:29012013-29012035 CACCTCCCGGACAGGGCGGCTGG - Intronic
1178580953 21:33838262-33838284 CAGCGCCGGGAGAACGCGAGGGG - Intronic
1179495269 21:41767175-41767197 CAGCGCCCGGTGACTGCGGACGG + Intergenic
1179658383 21:42859760-42859782 CAGCGCCCGCAGGGACCGGGAGG + Intronic
1179828991 21:43984213-43984235 CAGCTGCCCGAGTGGGCGGGTGG - Exonic
1182377243 22:29857844-29857866 CATCTCCCGGACAGGGCGGCTGG + Intergenic
1182547684 22:31085308-31085330 CGGCGCCCTGCGAGGGAGGGCGG + Intronic
1182551749 22:31104502-31104524 CGGTGCCCGGAGAGTGGGGGCGG - Exonic
1182586366 22:31346220-31346242 CGGCGGCTGGAGCGGGCGGGCGG + Exonic
1182638666 22:31749870-31749892 CCGCGCCCCGAGAGGGCGGGGGG + Intronic
1183384214 22:37505758-37505780 CAGGGCCCAGAGAGGGTGAGGGG - Intronic
1183501455 22:38181915-38181937 CCGCGCCCGAGGACGGCGGGAGG + Intronic
1183536414 22:38404216-38404238 CAGTGCTAGGGGAGGGCGGGAGG - Intergenic
1184289085 22:43488828-43488850 CAGCGCCTGAGGAGGGCGGACGG - Intronic
1184458322 22:44623931-44623953 CAGCACACAGAGAGGGCAGGCGG - Intergenic
1184676264 22:46045020-46045042 CGCCGCCGGGCGAGGGCGGGAGG - Intergenic
1185259087 22:49851785-49851807 CAGAGCCCGGAGAGGGGATGAGG + Intergenic
949105412 3:196866-196888 CAGCGGCGGGAGGGGACGGGCGG + Exonic
949569941 3:5283817-5283839 CACCTCCCGGACAGGGCGGCTGG + Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950637524 3:14325217-14325239 CAGAGCAGGGAGAGGGCTGGAGG - Intergenic
953357294 3:42266000-42266022 CGGTGCACGGAGAGGGCGAGGGG - Exonic
953440153 3:42909700-42909722 CACCTCCCGGAGGGGGCGGCTGG + Intronic
954155678 3:48683773-48683795 CAGGGCCAGGGGAGGGCTGGGGG - Intronic
954401345 3:50321352-50321374 CCGCGCGAGGTGAGGGCGGGCGG - Exonic
954523434 3:51249223-51249245 CACCTCCCGGACAGGGCGGCTGG - Intronic
954618554 3:51983126-51983148 CAGCCCCCGGATAGGGCGGGAGG - Intronic
954823009 3:53347670-53347692 CGGCGCCCGGAGCGTGCGCGCGG - Intergenic
955362791 3:58289830-58289852 CACCACCCGGACAGGGCGGCTGG + Intronic
955935235 3:64096675-64096697 CAGTGCCCGGAGGGGTCTGGAGG - Exonic
956761155 3:72446765-72446787 CAGTCCCCGGAAAGGGTGGGTGG - Exonic
958718963 3:97821973-97821995 CCGCGCCGGGCGAGGGCGGGAGG + Intergenic
958798621 3:98732487-98732509 CGGCGCCCGGCGAGGGCGCGCGG + Intronic
959683825 3:109124305-109124327 CACCTCCCGGACAGGGCGGCTGG - Intergenic
960747846 3:120908921-120908943 CAGCTGCCGGGGAGGGGGGGAGG - Intronic
960914293 3:122680977-122680999 CAGAGCCCGAAGAGGTCGGGAGG + Exonic
961163685 3:124750081-124750103 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961784419 3:129339807-129339829 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961788730 3:129362596-129362618 CACCTCCCGGACAGGGCGGCTGG + Intergenic
961789059 3:129363374-129363396 CACCTCCCGGACAGGGCGGCTGG + Intergenic
962245292 3:133785649-133785671 CACCTCCCGGACAGGGCGGCTGG - Intronic
964744953 3:160003655-160003677 CAGAGCCCAGGGAGGGCTGGAGG - Intergenic
964748858 3:160036497-160036519 CAGAGCCCAGGGAGGGCTGGAGG + Intergenic
966015043 3:175131737-175131759 CACCCCCCGGACAGGGCGGCTGG + Intronic
966808521 3:183824754-183824776 CAGTGACCGGAGAGAGCTGGGGG + Intronic
966912952 3:184569437-184569459 CAGCGACTGGAGCTGGCGGGCGG - Intronic
967176260 3:186864726-186864748 CACCTCCCGGACAGGGCGGCCGG - Intergenic
968505721 4:970452-970474 CAGAGCCCTTAGAGGGAGGGTGG + Intronic
968576622 4:1369243-1369265 CAGCCCCAGGCGAGGGCTGGAGG + Intronic
968836285 4:2966891-2966913 CAGGGACCAGAGAGGGAGGGGGG - Intronic
968852714 4:3094551-3094573 CACCTCCCGGACGGGGCGGGTGG + Intronic
968852755 4:3094635-3094657 CACCTCCCGGACGGGGCGGGTGG + Intronic
969477867 4:7431549-7431571 CTGCTCCTGGAGAGGGTGGGTGG + Intronic
971282009 4:25249406-25249428 CACCCCCCGGACAGGGCGGCTGG + Intronic
971296876 4:25401603-25401625 CAGTGCACGGAGAGGGCAGCTGG - Intronic
972047352 4:34683200-34683222 CAGCTACTGGAGAGGCCGGGAGG - Intergenic
972551727 4:40141184-40141206 CACCTCCCGGAGGGGGCGGCTGG + Intronic
975870758 4:78776324-78776346 CGGCTCCCGCAGAGGGCGGTGGG - Intronic
976607439 4:86996124-86996146 CACCTCCCGGACAGGGCGGCTGG - Intronic
979622616 4:122812594-122812616 CACCTCCCGGACAGGGCGGCTGG - Intergenic
981782675 4:148444911-148444933 CAGGGCCCGGGGAGGGGGCGCGG - Intergenic
981970850 4:150660505-150660527 CACCTCCCGGACAGGGCGGCTGG - Intronic
982040452 4:151391065-151391087 CACCTCCCGGACAGGGCGGCTGG - Intergenic
983218058 4:165019930-165019952 CACCTCCCGGACAGGGCGGCTGG + Intergenic
983218106 4:165020054-165020076 CACCTCCCGGACAGGGCGGCTGG + Intergenic
983652418 4:170046964-170046986 CACCTCCCGGACAGGGCGGCTGG - Intergenic
984533679 4:180945336-180945358 CACCTCCCGGACAGGGCGGCTGG - Intergenic
984852817 4:184168778-184168800 CAGAGCCCGGGCAGGGCCGGCGG + Intronic
984888786 4:184473646-184473668 CAGCGGCCGGGGCGGGAGGGCGG - Intronic
985408749 4:189662098-189662120 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
985995650 5:3595728-3595750 GAGCGGCCGGCGAGGGCGGGCGG + Intergenic
986337545 5:6766689-6766711 CAGCGAGGGGAGAGGGAGGGAGG - Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
987146213 5:14993889-14993911 CAGCACACGGAGCGGGTGGGAGG + Intergenic
987258319 5:16179639-16179661 GAGAGCGCGGAGGGGGCGGGAGG + Exonic
990459055 5:56015076-56015098 CACCTCCCGGACAGGGCGGCTGG + Intergenic
991073749 5:62513653-62513675 CACCTCCCGGACAGGGCGGTTGG + Intronic
991967473 5:72107368-72107390 CGGCGCTGGGAGAGGGCGGAGGG + Exonic
992374171 5:76172317-76172339 CACCTCCCGGACAGGGCGGCTGG - Intronic
992374225 5:76172446-76172468 CACCTCCCGGACAGGGCGGCTGG - Intronic
992469496 5:77042405-77042427 CACCTCCCGGACAGGGCGGCTGG + Intronic
992574517 5:78096908-78096930 CACCTCCCGGACAGGGCGGCTGG - Intronic
992801860 5:80301607-80301629 CACCTCCCGGACAGGGCGGTTGG - Intergenic
992978283 5:82140268-82140290 CACCTCCCGGACAGGGCGGCTGG - Intronic
993162808 5:84312475-84312497 CACCTCCCGGACAGGGCGGCTGG + Intronic
994185055 5:96807643-96807665 CAGGGCGCGGGAAGGGCGGGGGG - Intronic
995123562 5:108559223-108559245 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
995725858 5:115179866-115179888 CAGCGCCTGGGAAGGGCGGGAGG - Intronic
997335971 5:133109046-133109068 CACCTCCCGGACAGGGCGGCTGG - Intergenic
997336024 5:133109174-133109196 CACCTCCCGGACAGGGCGGCTGG - Intergenic
997874774 5:137537844-137537866 CACCTCCCGGACAGGGCGGCTGG + Intronic
997984451 5:138491884-138491906 CAGCCTCCGGAGAGGGCCCGAGG + Intergenic
998239443 5:140427739-140427761 CACCTCCCGGACAGGGCGGCTGG + Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
1001057866 5:168464352-168464374 CAGTGTACAGAGAGGGCGGGTGG + Intronic
1002259089 5:177981947-177981969 CAGAGCCCAGAGAGGTTGGGGGG + Intergenic
1002570512 5:180137049-180137071 AAGCGGCAGCAGAGGGCGGGAGG + Intronic
1003377492 6:5593290-5593312 CAGAGGCCGGTGGGGGCGGGAGG - Intronic
1004043902 6:12009020-12009042 CAGCGCGCGCGGAGGGCGGAGGG + Intronic
1004235510 6:13872005-13872027 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1006014129 6:31067197-31067219 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1006141312 6:31931858-31931880 CACCTCCCGGACAGGGCGGCTGG + Intronic
1006148863 6:31975874-31975896 CACCTCCCGGACAGGGCGGCTGG + Intronic
1007390163 6:41546287-41546309 GAGCGCGCGGAGAGCGAGGGAGG - Intergenic
1007784068 6:44270460-44270482 CGGCGGCGGGAGCGGGCGGGAGG + Exonic
1007851601 6:44808115-44808137 CAAGGGCCGGTGAGGGCGGGGGG - Intergenic
1008624691 6:53305294-53305316 CACCTCCCGGACAGGGCGGCTGG + Intronic
1013507426 6:110814731-110814753 GAGTGCTCGGAGACGGCGGGGGG - Intronic
1014137734 6:117907908-117907930 CGGCGCCGGGCGAGGGCGCGGGG + Intronic
1014736171 6:125098435-125098457 CAGCCCCCGGAGTGGGTGGGTGG + Intergenic
1015156432 6:130101607-130101629 CAGGGCCTGGAAAGGGCAGGGGG + Intronic
1015643663 6:135364035-135364057 CACCTCCCGGACAGGGCGGCTGG + Intronic
1016662611 6:146598921-146598943 CAGCGCCCGGAGAGCGGGGGCGG - Intergenic
1017174939 6:151494052-151494074 CGGCGCCGGGAGCCGGCGGGTGG - Exonic
1017830809 6:158127268-158127290 CACCTCCCGGACAGGGCGGCTGG - Intronic
1018757178 6:166860354-166860376 CAGCCCCAGGAGAGGGCAGATGG - Intronic
1018768944 6:166955968-166955990 CAGCGACTGGGGAGGGCGGGGGG - Intronic
1019022886 6:168933175-168933197 CAGCCCACGGAGAGAGAGGGAGG + Intergenic
1019635324 7:2072416-2072438 GAGCGCCTGGAGGGGGCAGGGGG - Intronic
1019701420 7:2476472-2476494 GAGCGCCGGGGGAGGGCTGGGGG + Intronic
1019944230 7:4314021-4314043 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1020125158 7:5529489-5529511 CAGCCCCGGGAGCGGGCGGGAGG - Intronic
1020235046 7:6348786-6348808 CGCGGCGCGGAGAGGGCGGGCGG - Exonic
1020325936 7:6975178-6975200 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1020347598 7:7182537-7182559 CAGCGCCAGGAGACTTCGGGTGG + Intronic
1020660350 7:10974119-10974141 CAGGGCCAGGCGAGGCCGGGGGG + Exonic
1021489276 7:21201067-21201089 CAGCGTCCGGGGTGGGCCGGGGG + Intergenic
1021868391 7:24980258-24980280 CGGGGCCCCGAGGGGGCGGGAGG + Intronic
1021872688 7:25019438-25019460 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1022318155 7:29263992-29264014 CAGCTCCCGGATGGGGCGGCTGG - Intronic
1022517484 7:30985113-30985135 CAGAGACCCCAGAGGGCGGGTGG - Intronic
1023160627 7:37292813-37292835 CACCTCCCGGACAGGGCGGCTGG - Intronic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1025695750 7:63773436-63773458 CTGCGCCTGGAGAGGCCGTGGGG - Intergenic
1025853374 7:65259386-65259408 CACCTCCCGGACAGGGCGGCCGG - Intergenic
1026895569 7:74008162-74008184 CAGCGCCAGGAGGGTGCGGTAGG + Intergenic
1027698248 7:81437173-81437195 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1028227414 7:88266525-88266547 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
1028567213 7:92246236-92246258 CAGCGGCCGGAGAGGGATGGGGG + Exonic
1029334355 7:99887904-99887926 CACCTCCCGGACAGGGCGGCTGG + Intronic
1029568983 7:101358719-101358741 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1029813980 7:103075229-103075251 CAGCGCCGGGCCAGGGCAGGAGG - Exonic
1032569789 7:132985399-132985421 CACCTCCCGGATAGGGCGGCTGG - Intronic
1033253251 7:139777961-139777983 CAGCGCGCGGCCAGGGCCGGCGG + Intronic
1034723426 7:153315091-153315113 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1035368531 7:158363716-158363738 GAGAGCCAGGAGAGGTCGGGAGG + Intronic
1035705999 8:1675351-1675373 CAGCCCCAGGAGAGAGCTGGCGG - Intronic
1037482008 8:19313925-19313947 CAGGGGCCAGAGCGGGCGGGCGG + Intronic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1040470655 8:47733604-47733626 CACCGCACGGGGAGGGAGGGTGG - Intronic
1041270264 8:56104242-56104264 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
1041693611 8:60714132-60714154 CAGCGCCCGGAGCCCGCGCGAGG + Intronic
1041693660 8:60714278-60714300 GAGCGCCCCGAGTGGGTGGGAGG - Intronic
1043346493 8:79303771-79303793 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1044430475 8:92102116-92102138 CAGAGCGCGCAGAGGTCGGGCGG + Intronic
1044660981 8:94591625-94591647 CACCTCCCGGACAGGGCGGCTGG - Intergenic
1045443775 8:102239504-102239526 GGGCGCCCGGAGTGGGCGAGCGG - Intergenic
1046616387 8:116482157-116482179 CAGCAGCAGGAGAGGGCAGGAGG - Intergenic
1047381969 8:124372415-124372437 CAGCGCCCGGAGAGGGCGGGCGG + Exonic
1047781914 8:128118410-128118432 CACCTCCCGGAGGGGGCGGCTGG + Intergenic
1047961736 8:130016282-130016304 TTGCCCCCGGAGAGGGCGCGGGG - Intronic
1048899217 8:139021964-139021986 CAGGGCCAGGAGAGGGAGAGGGG + Intergenic
1049053924 8:140220173-140220195 CAGCGCCAGGGGAGGGTGGTGGG + Intronic
1049114421 8:140673666-140673688 CAGCACTCGGTGAGGGCTGGTGG + Intronic
1049212249 8:141392164-141392186 CCGTGCCCGGAGCGGGCGGCGGG - Intronic
1049749067 8:144275033-144275055 CAGAGACCGGATCGGGCGGGCGG + Intronic
1049812187 8:144580572-144580594 CAGGGCCAGGTGAGGGCGGTGGG - Intronic
1050537715 9:6645190-6645212 CAGAGCCCGGGCAGGGCGGAGGG + Intronic
1052858749 9:33423685-33423707 CACCTCCCGGATAGGGCGGCTGG - Intergenic
1052861394 9:33439939-33439961 CATGGTCCAGAGAGGGCGGGTGG - Intergenic
1052951512 9:34217031-34217053 CAGAGGCCGGAGAGGTGGGGAGG - Intronic
1053153415 9:35757036-35757058 CAGGTCCCGGAGGGGGCGGCTGG + Exonic
1055138546 9:72851018-72851040 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1055580481 9:77702817-77702839 CAGCTCCCGGACGGGGCGGCTGG + Intergenic
1055580500 9:77702859-77702881 CAGCTCCCGGACGGGGCGGCTGG + Intergenic
1056135086 9:83623223-83623245 TAGGTCCGGGAGAGGGCGGGGGG + Intronic
1057072858 9:92115256-92115278 CCGGGCCCGGGGAGGGTGGGAGG - Intronic
1057087782 9:92227400-92227422 CACCTCCCGGACAGGGCGGCTGG + Intronic
1059211278 9:112514879-112514901 CACCTCCCGGACAGGGCGGCTGG - Intronic
1060065272 9:120496407-120496429 CACCTCCCGGACAGGGCGGCTGG - Intronic
1060350241 9:122852654-122852676 CACCTCCCGGACAGGGCGGCTGG - Intronic
1060584423 9:124777281-124777303 CAGCGGCCGGGGCGGGAGGGCGG - Exonic
1060682562 9:125577831-125577853 CAGCTCCCGGACGGGGCGGTTGG - Intronic
1060966493 9:127714943-127714965 GAGCGCCAGGGGTGGGCGGGCGG - Intronic
1061297526 9:129685056-129685078 CAGCCCAGGGAGAGGGCAGGAGG - Intronic
1062004435 9:134232114-134232136 CAGCCCCAGGGGAGGGCAGGAGG - Intergenic
1062022298 9:134325450-134325472 CAGCCGCCCGAGACGGCGGGCGG + Intronic
1062291744 9:135798421-135798443 CAGGGCCCGAGCAGGGCGGGTGG - Intergenic
1062341525 9:136095646-136095668 CGGGGCCCGGGGAGGGCGGAGGG - Intergenic
1062352190 9:136144666-136144688 CAGGGCCCGGAGTGGGTGGCGGG - Intergenic
1062498934 9:136844131-136844153 CATCGCAGGGAGAGGACGGGGGG + Intronic
1203659827 Un_KI270753v1:31523-31545 CAGCGCCAGGATTGGGCAGGAGG + Intergenic
1186475977 X:9857982-9858004 CAGCGCTCGCAGAGGCTGGGAGG - Intronic
1186496246 X:10014919-10014941 GAGCGCGCGGAGAGGGAGGACGG + Intergenic
1187281639 X:17861534-17861556 GAGCGCCGGGGGAGGGCCGGAGG + Intergenic
1189310048 X:40012510-40012532 CGGCGCGGGGAGAGGACGGGAGG + Intergenic
1189322635 X:40096071-40096093 CCGCGCTCGGAGCCGGCGGGCGG - Intronic
1189837583 X:45040363-45040385 CACCTCCCGGACAGGGCGGCTGG + Intronic
1190241281 X:48659535-48659557 CACCTCCCGGACAGGGCGGCTGG + Intergenic
1190598747 X:52069088-52069110 CAGGACCGGGAGAGGGCGAGTGG - Intronic
1190610077 X:52184985-52185007 CAGGACCGGGAGAGGGCGAGTGG + Intronic
1191618605 X:63192656-63192678 CAGCCCACGGAGAGGGTGGGAGG + Intergenic
1192495840 X:71616286-71616308 CAGAGCCGGCAGAGGGAGGGAGG + Exonic
1192561706 X:72131761-72131783 CCGGGGCCGGAGAGGGCGGGCGG + Exonic
1195217089 X:102712859-102712881 CTGTGCCCGGAGAGGGCTGTGGG + Intronic
1196845089 X:119890867-119890889 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1197460780 X:126737937-126737959 CAGCTCCAGGAGAGGGAGGGAGG - Intergenic
1199199165 X:145066994-145067016 CAGCACTTGGGGAGGGCGGGTGG - Intergenic