ID: 1047382121

View in Genome Browser
Species Human (GRCh38)
Location 8:124373010-124373032
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047382121_1047382128 15 Left 1047382121 8:124373010-124373032 CCGGCGTGCGGCCCCGCTCTGGA No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data
1047382121_1047382131 22 Left 1047382121 8:124373010-124373032 CCGGCGTGCGGCCCCGCTCTGGA No data
Right 1047382131 8:124373055-124373077 CCCCAGCCCCGACGGGATCACGG No data
1047382121_1047382127 14 Left 1047382121 8:124373010-124373032 CCGGCGTGCGGCCCCGCTCTGGA No data
Right 1047382127 8:124373047-124373069 CGCTGCCACCCCAGCCCCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047382121 Original CRISPR TCCAGAGCGGGGCCGCACGC CGG (reversed) Intergenic