ID: 1047382125

View in Genome Browser
Species Human (GRCh38)
Location 8:124373022-124373044
Sequence GCTCTCCGCCTGTCCAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047382125_1047382131 10 Left 1047382125 8:124373022-124373044 CCCGCTCTGGACAGGCGGAGAGC No data
Right 1047382131 8:124373055-124373077 CCCCAGCCCCGACGGGATCACGG No data
1047382125_1047382137 23 Left 1047382125 8:124373022-124373044 CCCGCTCTGGACAGGCGGAGAGC No data
Right 1047382137 8:124373068-124373090 GGGATCACGGCGCTCTGCTCCGG No data
1047382125_1047382127 2 Left 1047382125 8:124373022-124373044 CCCGCTCTGGACAGGCGGAGAGC No data
Right 1047382127 8:124373047-124373069 CGCTGCCACCCCAGCCCCGACGG No data
1047382125_1047382128 3 Left 1047382125 8:124373022-124373044 CCCGCTCTGGACAGGCGGAGAGC No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047382125 Original CRISPR GCTCTCCGCCTGTCCAGAGC GGG (reversed) Intergenic