ID: 1047382128

View in Genome Browser
Species Human (GRCh38)
Location 8:124373048-124373070
Sequence GCTGCCACCCCAGCCCCGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047382125_1047382128 3 Left 1047382125 8:124373022-124373044 CCCGCTCTGGACAGGCGGAGAGC No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data
1047382119_1047382128 16 Left 1047382119 8:124373009-124373031 CCCGGCGTGCGGCCCCGCTCTGG No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data
1047382118_1047382128 17 Left 1047382118 8:124373008-124373030 CCCCGGCGTGCGGCCCCGCTCTG No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data
1047382124_1047382128 4 Left 1047382124 8:124373021-124373043 CCCCGCTCTGGACAGGCGGAGAG No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data
1047382126_1047382128 2 Left 1047382126 8:124373023-124373045 CCGCTCTGGACAGGCGGAGAGCT No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data
1047382121_1047382128 15 Left 1047382121 8:124373010-124373032 CCGGCGTGCGGCCCCGCTCTGGA No data
Right 1047382128 8:124373048-124373070 GCTGCCACCCCAGCCCCGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047382128 Original CRISPR GCTGCCACCCCAGCCCCGAC GGG Intergenic