ID: 1047382137

View in Genome Browser
Species Human (GRCh38)
Location 8:124373068-124373090
Sequence GGGATCACGGCGCTCTGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047382130_1047382137 -10 Left 1047382130 8:124373055-124373077 CCCCAGCCCCGACGGGATCACGG No data
Right 1047382137 8:124373068-124373090 GGGATCACGGCGCTCTGCTCCGG No data
1047382126_1047382137 22 Left 1047382126 8:124373023-124373045 CCGCTCTGGACAGGCGGAGAGCT No data
Right 1047382137 8:124373068-124373090 GGGATCACGGCGCTCTGCTCCGG No data
1047382129_1047382137 -7 Left 1047382129 8:124373052-124373074 CCACCCCAGCCCCGACGGGATCA No data
Right 1047382137 8:124373068-124373090 GGGATCACGGCGCTCTGCTCCGG No data
1047382124_1047382137 24 Left 1047382124 8:124373021-124373043 CCCCGCTCTGGACAGGCGGAGAG No data
Right 1047382137 8:124373068-124373090 GGGATCACGGCGCTCTGCTCCGG No data
1047382125_1047382137 23 Left 1047382125 8:124373022-124373044 CCCGCTCTGGACAGGCGGAGAGC No data
Right 1047382137 8:124373068-124373090 GGGATCACGGCGCTCTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047382137 Original CRISPR GGGATCACGGCGCTCTGCTC CGG Intergenic