ID: 1047384224

View in Genome Browser
Species Human (GRCh38)
Location 8:124394748-124394770
Sequence CTCCCATGGGACCTCAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047384224_1047384231 10 Left 1047384224 8:124394748-124394770 CCCTCACTGAGGTCCCATGGGAG No data
Right 1047384231 8:124394781-124394803 ATGTCTTCAGTGGCAGATGAAGG No data
1047384224_1047384228 0 Left 1047384224 8:124394748-124394770 CCCTCACTGAGGTCCCATGGGAG No data
Right 1047384228 8:124394771-124394793 TATCCCAGATATGTCTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047384224 Original CRISPR CTCCCATGGGACCTCAGTGA GGG (reversed) Intergenic
No off target data available for this crispr