ID: 1047386557

View in Genome Browser
Species Human (GRCh38)
Location 8:124415545-124415567
Sequence TGGACTTTGCCTAAAATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047386557_1047386559 4 Left 1047386557 8:124415545-124415567 CCTGAAATTTTAGGCAAAGTCCA No data
Right 1047386559 8:124415572-124415594 GTATATCCATTACTCTGCAGAGG No data
1047386557_1047386560 5 Left 1047386557 8:124415545-124415567 CCTGAAATTTTAGGCAAAGTCCA No data
Right 1047386560 8:124415573-124415595 TATATCCATTACTCTGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047386557 Original CRISPR TGGACTTTGCCTAAAATTTC AGG (reversed) Intergenic
No off target data available for this crispr