ID: 1047388376

View in Genome Browser
Species Human (GRCh38)
Location 8:124430428-124430450
Sequence GTACAGTGGGAAGACAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047388365_1047388376 23 Left 1047388365 8:124430382-124430404 CCAGATTGTGCTGGACTTAGGTG No data
Right 1047388376 8:124430428-124430450 GTACAGTGGGAAGACAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047388376 Original CRISPR GTACAGTGGGAAGACAGTGG AGG Intergenic
No off target data available for this crispr