ID: 1047389450

View in Genome Browser
Species Human (GRCh38)
Location 8:124438300-124438322
Sequence ACCAGGGCTGTTAAGGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047389450_1047389455 4 Left 1047389450 8:124438300-124438322 CCAAGGACCTTAACAGCCCTGGT No data
Right 1047389455 8:124438327-124438349 ACTGCAGTGCTTACTGCCAAGGG No data
1047389450_1047389454 3 Left 1047389450 8:124438300-124438322 CCAAGGACCTTAACAGCCCTGGT No data
Right 1047389454 8:124438326-124438348 CACTGCAGTGCTTACTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047389450 Original CRISPR ACCAGGGCTGTTAAGGTCCT TGG (reversed) Intergenic
No off target data available for this crispr