ID: 1047396319

View in Genome Browser
Species Human (GRCh38)
Location 8:124502371-124502393
Sequence GCCTGGATAGTTAATGAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047396319_1047396324 23 Left 1047396319 8:124502371-124502393 CCCCTTTCATTAACTATCCAGGC No data
Right 1047396324 8:124502417-124502439 AAAAAAATTCATTTTCAAAATGG No data
1047396319_1047396325 24 Left 1047396319 8:124502371-124502393 CCCCTTTCATTAACTATCCAGGC No data
Right 1047396325 8:124502418-124502440 AAAAAATTCATTTTCAAAATGGG No data
1047396319_1047396322 -9 Left 1047396319 8:124502371-124502393 CCCCTTTCATTAACTATCCAGGC No data
Right 1047396322 8:124502385-124502407 TATCCAGGCTAACTTGTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047396319 Original CRISPR GCCTGGATAGTTAATGAAAG GGG (reversed) Intronic