ID: 1047401099

View in Genome Browser
Species Human (GRCh38)
Location 8:124548163-124548185
Sequence TCAGAAGCCAACTTCAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047401098_1047401099 1 Left 1047401098 8:124548139-124548161 CCTGTGAGACATCAAGTGCAGAT 0: 1
1: 1
2: 1
3: 20
4: 188
Right 1047401099 8:124548163-124548185 TCAGAAGCCAACTTCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047401099 Original CRISPR TCAGAAGCCAACTTCAGATG TGG Intronic
No off target data available for this crispr