ID: 1047401306

View in Genome Browser
Species Human (GRCh38)
Location 8:124549855-124549877
Sequence GGTATATTGTGACCAGACCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 2, 1: 1, 2: 0, 3: 6, 4: 58}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047401297_1047401306 14 Left 1047401297 8:124549818-124549840 CCTGCCCGAAAGGAAGGTGATTT 0: 1
1: 1
2: 1
3: 7
4: 80
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58
1047401295_1047401306 16 Left 1047401295 8:124549816-124549838 CCCCTGCCCGAAAGGAAGGTGAT 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58
1047401294_1047401306 17 Left 1047401294 8:124549815-124549837 CCCCCTGCCCGAAAGGAAGGTGA 0: 1
1: 1
2: 1
3: 9
4: 129
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58
1047401298_1047401306 10 Left 1047401298 8:124549822-124549844 CCCGAAAGGAAGGTGATTTGCCC 0: 2
1: 1
2: 2
3: 26
4: 202
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58
1047401296_1047401306 15 Left 1047401296 8:124549817-124549839 CCCTGCCCGAAAGGAAGGTGATT 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58
1047401302_1047401306 -10 Left 1047401302 8:124549842-124549864 CCCCCACTGTGGTGGTATATTGT 0: 1
1: 1
2: 1
3: 7
4: 121
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58
1047401299_1047401306 9 Left 1047401299 8:124549823-124549845 CCGAAAGGAAGGTGATTTGCCCC 0: 1
1: 0
2: 2
3: 11
4: 160
Right 1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG 0: 2
1: 1
2: 0
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047401306 Original CRISPR GGTATATTGTGACCAGACCC CGG Exonic
905210022 1:36367574-36367596 GGTATAGTGTGACCAGGTCCAGG + Intronic
905916319 1:41686927-41686949 TGTATATTGTGCCCAGTGCCTGG - Intronic
913286535 1:117231815-117231837 AGTATCTTGTGATCAGACCAGGG - Intergenic
915967580 1:160324887-160324909 GGTATATTGTGACAGAATCCTGG + Intronic
920397748 1:205659287-205659309 AGTAAATGGCGACCAGACCCAGG + Exonic
1064010123 10:11729050-11729072 GGAGTATTGTGACCTGACCAAGG + Intergenic
1069204858 10:65668683-65668705 GGAACATTGTGACCTGACCAAGG + Intergenic
1071687619 10:87776855-87776877 AGTATATAGTGATCAGACCAGGG - Intronic
1074452900 10:113573872-113573894 AGTATAGTGTGATCTGACCCCGG + Intronic
1080779573 11:35418610-35418632 GGCATAGTGTGAGCAGACACCGG - Intronic
1081029019 11:38054274-38054296 AGTAGATTTTGACAAGACCCTGG - Intergenic
1090877037 11:130799529-130799551 TGTATAGTGCGACCAGACCAAGG + Intergenic
1111230833 13:85341838-85341860 GGTATATCCTGACCACAGCCAGG - Intergenic
1111425527 13:88075563-88075585 GGTTTATGGTTACCAGTCCCTGG - Intergenic
1115733201 14:36294565-36294587 GATATTTTGTGACAAGAACCTGG - Intergenic
1117277869 14:54207820-54207842 GGTAAGTTGTGATCAGAGCCTGG + Intergenic
1129072382 15:72962082-72962104 TGTATGTGGTGAGCAGACCCAGG - Intergenic
1131105636 15:89732302-89732324 GGTAGCTTGTGATCAGACCAGGG + Intronic
1144111472 17:12038829-12038851 TGTAAACTGTGACCAGACCAAGG - Intronic
1144450595 17:15374805-15374827 GGCATACTGTGAGCAGAGCCAGG + Intergenic
1145870318 17:28268255-28268277 GCTAGATTGGGACCAGAACCAGG + Intergenic
1147246191 17:39122559-39122581 GGATTATAGTGACCATACCCTGG - Intronic
1147250383 17:39149712-39149734 GGGAGATAGTGGCCAGACCCGGG - Intronic
1151401247 17:73857423-73857445 GGTATTTAGTGAGCAGAGCCTGG + Intergenic
1152342929 17:79735204-79735226 AGTAGAGTGTGACCAGATCCAGG - Exonic
1152793933 17:82297635-82297657 GCTATTTTGTGACCAGCCCCTGG + Intergenic
1157035398 18:43966733-43966755 GGTATAATGTAGCCAGACCTGGG - Intergenic
1157529203 18:48407995-48408017 GATATACTGTGCCCAGACCTGGG - Intronic
1164201350 19:23021500-23021522 GGGATATTGTGACAAGTCGCTGG - Intergenic
930319268 2:49833610-49833632 GGTATATTGTGAGCAGAGCAAGG + Intergenic
932968020 2:76501318-76501340 GGTAGACTGTGACCAGAGCTTGG - Intergenic
934858559 2:97744363-97744385 GGTATAATATGACAAGGCCCTGG + Intergenic
936984087 2:118291497-118291519 GATCAATTGTGTCCAGACCCTGG - Intergenic
940242995 2:151583429-151583451 CGTATATTATCGCCAGACCCCGG - Intronic
940243950 2:151593981-151594003 CGTATATTATCGCCAGACCCCGG - Intronic
940244910 2:151604534-151604556 CGTATATTATCGCCAGACCCCGG - Intronic
944499328 2:200342112-200342134 GGTATATGGTGAATAGACACTGG - Intronic
1170519182 20:17166067-17166089 GGAACATTGTGACCTGACCAAGG - Intergenic
963406056 3:144865790-144865812 GGCACATTGTCACCAGACTCTGG + Intergenic
969109956 4:4838402-4838424 GGTTTATAGTGACCAGGCCCAGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
981195709 4:141917905-141917927 GGAATGGTGTGAACAGACCCTGG + Intergenic
991705148 5:69350411-69350433 GGTATATTGTGACCAGACCCCGG + Intergenic
994346726 5:98696483-98696505 GGTATATTCAGACCAGCCACAGG - Intergenic
998498229 5:142609539-142609561 GGCATAATGTGCCCAGACACAGG - Intronic
1004527234 6:16420300-16420322 GCTATCTTGTGAACAGTCCCAGG + Intronic
1004639049 6:17496211-17496233 GGTATTCTGTGAATAGACCCAGG - Intronic
1010911009 6:81556438-81556460 GTTCTAATGTGACCATACCCTGG + Intronic
1013909831 6:115261606-115261628 GATATTCTGTGACCAGACCACGG - Intergenic
1017189202 6:151633949-151633971 GGCATATTTTGAGCATACCCAGG + Intergenic
1019934400 7:4244903-4244925 AGTATGTTGTGAACAGCCCCTGG - Intronic
1020132656 7:5568118-5568140 GGTAAATTGGGACCAGAGTCTGG - Intergenic
1021608310 7:22431849-22431871 GGAATAATGTTACCAGAGCCTGG - Intronic
1029223543 7:99008763-99008785 GGTTTGTTATGACCAGACACGGG + Intronic
1032418024 7:131753758-131753780 GGCATATTGTGACCAGACCCTGG - Intergenic
1033862046 7:145640613-145640635 GGTATGTTCTGTCCATACCCAGG + Intergenic
1034027871 7:147726614-147726636 GGAGCATTGTGACCTGACCCAGG - Intronic
1036122303 8:6031700-6031722 GGGATATGGTGACCACACCAAGG + Intergenic
1047401306 8:124549855-124549877 GGTATATTGTGACCAGACCCCGG + Exonic
1048021586 8:130544578-130544600 GGTAGATTGTGGCCAGACACCGG - Intergenic
1049368337 8:142251661-142251683 GGTATATGGTGCCCAGGCCCTGG - Intronic
1192117744 X:68427606-68427628 GGTATAATGGGACAAAACCCTGG - Intronic
1192153709 X:68727535-68727557 GGTAGATGGTGGTCAGACCCAGG + Intergenic
1192760474 X:74090663-74090685 GCTATATTGTGTCCATGCCCTGG - Intergenic
1193515827 X:82461993-82462015 GGTATTTTGAGACCAGATCTTGG + Intergenic
1196273356 X:113737796-113737818 GATATATTTTGAACAGCCCCAGG + Intergenic
1197798369 X:130322322-130322344 GGAGTATTGTGACCTGACCAAGG + Intergenic