ID: 1047403212

View in Genome Browser
Species Human (GRCh38)
Location 8:124563048-124563070
Sequence AGTGGTAAGAGGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1401
Summary {0: 1, 1: 1, 2: 7, 3: 131, 4: 1261}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047403212 Original CRISPR AGTGGTAAGAGGAAGGAGGA AGG Intronic
900384084 1:2401403-2401425 AGAGGAAGGAGGAAGGAGGGAGG - Intronic
900384087 1:2401410-2401432 ATGGGAGAGAGGAAGGAGGAAGG - Intronic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
901169543 1:7246628-7246650 AGGGATCAGAGGAAGGAGGAGGG - Intronic
901411550 1:9087829-9087851 AGAGAGAAGAGGAAGGAAGAGGG - Intronic
901447908 1:9319404-9319426 AGAGGAGGGAGGAAGGAGGAGGG - Intronic
901447911 1:9319411-9319433 AGGAGGAAGAGGAGGGAGGAAGG - Intronic
901905997 1:12411534-12411556 AGAGGGAAGAGGAGGGAGGGAGG + Intronic
902220083 1:14959082-14959104 AGAGCAAAGAGGAAGGAGGCCGG + Intronic
902527770 1:17070398-17070420 AGTCGTAATAGGACAGAGGAAGG + Intronic
902548020 1:17202362-17202384 AGAGGAAAGAGGAAAGAGAAAGG - Intergenic
902719668 1:18295668-18295690 AGGGGTAAGAGGAAGTGGGCAGG - Intronic
903047272 1:20574157-20574179 GGAGGAGAGAGGAAGGAGGAAGG + Intergenic
903305987 1:22413721-22413743 CCAGGGAAGAGGAAGGAGGAAGG - Intergenic
903560371 1:24222429-24222451 AGTGGGAAGAGGGAGGAGCAGGG + Intergenic
903642169 1:24867607-24867629 GGTGGTAGGAGGTAGGAGGTAGG + Intergenic
903734746 1:25522965-25522987 GGTGGTAAGAAGAAGGGTGAGGG + Intergenic
903926636 1:26835130-26835152 AGTGGCAGAGGGAAGGAGGAGGG + Intronic
904087191 1:27917133-27917155 AGGAGGAAGGGGAAGGAGGAAGG - Intergenic
904131802 1:28281050-28281072 TGTGGGCAGGGGAAGGAGGAAGG - Exonic
904295760 1:29518852-29518874 AGGAGAATGAGGAAGGAGGAAGG - Intergenic
904306562 1:29593915-29593937 AGGGGGAAGAGGGAGGAGAAGGG + Intergenic
904309773 1:29621237-29621259 AGTGGGAATGGGAAGGAGAAGGG + Intergenic
904638096 1:31900209-31900231 ATAGGACAGAGGAAGGAGGACGG - Intergenic
904652351 1:32014657-32014679 AGCCGCAAGAGGAGGGAGGAGGG - Intronic
904966724 1:34379928-34379950 AGGGGTTAGAGGGAGGAGGAGGG + Intergenic
905256448 1:36688506-36688528 TGTGGGAAGGGGAAGGAGTATGG + Intergenic
905256468 1:36688560-36688582 AATGGGAAGGGGAAGGAGTATGG + Intergenic
905256489 1:36688614-36688636 AATGGGAAGGGGAAGGAGTATGG + Intergenic
905256510 1:36688668-36688690 AATGGGAAGGGGAAGGAGTATGG + Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905509005 1:38503536-38503558 AGAGGAAACAGGAAGGAGGAAGG + Intergenic
905679257 1:39855734-39855756 AGTGGAAAGAGGAAAGAAGATGG + Intronic
905703696 1:40038916-40038938 AGAGAGAAGAGGAAGCAGGAAGG - Intergenic
905726378 1:40255361-40255383 TGTGGAAAGAGTAAGGAAGAGGG - Intergenic
905781695 1:40716456-40716478 AGTGGTAAAAGAAAGAAGTATGG + Intronic
905942918 1:41878682-41878704 AGAGGGAGGAGGAGGGAGGAGGG - Intronic
906108872 1:43310263-43310285 AGTGAGAAGAGAAAGGCGGAAGG - Intronic
906289876 1:44612904-44612926 AGTGGGAAGAAGAAGAAGGAAGG + Intronic
907117123 1:51978712-51978734 AGTGGTCAGAGGAGGGTGGGAGG + Intronic
907127467 1:52063562-52063584 ACTGGTAGGAGTAAGGAGAAAGG - Intronic
907221993 1:52913876-52913898 AAAGGTAGGAGGAAGGAGAATGG - Intronic
907623084 1:56001701-56001723 ACTGGCAAGAGGTTGGAGGATGG + Intergenic
908702715 1:66919921-66919943 AGTGGGAAGATGTAGGGGGAGGG - Intronic
909141266 1:71868843-71868865 AGTGGTGAGAGGGAGAAGGTGGG - Intronic
909227236 1:73041508-73041530 TGGGGCAAGAGGCAGGAGGATGG - Intergenic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909365187 1:74812584-74812606 AGTGGTAAGAATAAGGAGCAGGG - Intergenic
909813545 1:79961056-79961078 TGTGATAAGAGGAAGGTGGCTGG + Intergenic
909899942 1:81120709-81120731 AATGGGAAGAGGAAAGAGCATGG - Intergenic
910654132 1:89602964-89602986 AGTGAGAAGAGTGAGGAGGAGGG + Intergenic
910856155 1:91697948-91697970 AGGGGAAAGGGGAAGGGGGAAGG + Intronic
911094381 1:94043999-94044021 AAAGGGAAGGGGAAGGAGGAAGG - Intronic
911752564 1:101514171-101514193 AGTGGGCTGAGGCAGGAGGATGG - Intergenic
911781014 1:101878558-101878580 AGTGGTTATAGGAAGCAGTAGGG + Intronic
911948399 1:104139718-104139740 AGGGGGATGAGGCAGGAGGATGG - Intergenic
912148173 1:106820373-106820395 AGTGCTAAGAGGAACCAGGGTGG - Intergenic
912363507 1:109114001-109114023 AGAGGACAGAGGGAGGAGGAAGG + Exonic
912697156 1:111850080-111850102 GGTGGTAAGATGCAGCAGGAAGG - Intronic
912700167 1:111872189-111872211 ACAGGTAAGAGGACAGAGGATGG + Intronic
912925183 1:113906823-113906845 GATGGGAAGTGGAAGGAGGAAGG + Intronic
913074385 1:115329082-115329104 AGTAGAAAGAGGAAGGGAGAAGG + Intronic
914757818 1:150574919-150574941 AGTGGTTTGGGAAAGGAGGAGGG - Exonic
914871321 1:151477250-151477272 GGTGATAAGAGGAAGGAGCTGGG - Intergenic
914960101 1:152197497-152197519 AGGGGAAAAAGGAAGGGGGAAGG - Intergenic
915148087 1:153807373-153807395 AGAAGGATGAGGAAGGAGGAGGG + Exonic
915479537 1:156175488-156175510 AGTGGGAAGAGGAAGGAGGAAGG - Intronic
915916462 1:159943707-159943729 ACTGGGAAGAGAAAGGAGGGAGG + Intronic
915974297 1:160375006-160375028 AGTGGGAAGAGGAGGGAGCAGGG + Intergenic
916046676 1:161005275-161005297 AGGGGAAGGAGGAAGGAGGGAGG - Intronic
916222127 1:162455156-162455178 TGGGGTGGGAGGAAGGAGGAGGG + Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916691086 1:167190622-167190644 AATGGTAAAAGGAAGGAGAGGGG - Intergenic
916697610 1:167255599-167255621 AGTGGTATGAGAATGGAGGTAGG + Intronic
916946838 1:169737808-169737830 AGGGGAAAGAGCAAGCAGGAGGG - Intronic
917313594 1:173702595-173702617 AGGAGAAGGAGGAAGGAGGAAGG + Intergenic
917783769 1:178429439-178429461 AGTGGTCAGAGAATGGAGAATGG - Intronic
918069503 1:181124556-181124578 AGGAGGAAGAGGAACGAGGAAGG - Intergenic
918352265 1:183669645-183669667 AGTGGTAAGGTGTAGGAAGAAGG + Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
918757231 1:188354370-188354392 AGTTGTAAAAATAAGGAGGAGGG - Intergenic
918833982 1:189435533-189435555 AAGGGGAAGGGGAAGGAGGAAGG + Intergenic
919434828 1:197544961-197544983 AGGAGAAGGAGGAAGGAGGAAGG + Intronic
919814323 1:201428182-201428204 AGTGCTAGAATGAAGGAGGAAGG + Intronic
919822805 1:201483658-201483680 AGTGGTGGGAGGAAGGGGAAAGG - Exonic
919878203 1:201885826-201885848 AGTGGGGAAAGGCAGGAGGAGGG - Intergenic
920291629 1:204927707-204927729 AGTGGTCAGAGGGAGGGGGATGG - Intronic
920847268 1:209604612-209604634 AGTGGTAAGGGGGACTAGGAGGG + Intronic
920884449 1:209913010-209913032 AGTGAGAAGAGGAAGGAAGGAGG - Intergenic
921298685 1:213728717-213728739 AGTGGTGGGAGGAGGGGGGATGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921812190 1:219527635-219527657 AGTGGGAAGAGGAGGGAGGCAGG + Intergenic
921854483 1:219967050-219967072 AATAGGTAGAGGAAGGAGGAAGG - Intergenic
921963734 1:221065168-221065190 AGTGTTGACAGGAAAGAGGATGG - Intergenic
922422888 1:225471407-225471429 AGTAGTGAGAGGTAGGAGGAAGG + Intergenic
922471327 1:225879192-225879214 TGTGGGGACAGGAAGGAGGAGGG - Intronic
922480442 1:225936955-225936977 GGTGCTAAGAGGAAGGATGAAGG - Exonic
922574889 1:226654944-226654966 AGGAGGAAGAGGAGGGAGGAGGG + Intronic
922722572 1:227906319-227906341 AGTAGGAGGAGGGAGGAGGAGGG - Intergenic
922914850 1:229248943-229248965 AGTGGTAAGAAGTAGGAAGTAGG + Intergenic
923268472 1:232334599-232334621 AGGGGCAAAAGGGAGGAGGAAGG - Intergenic
923306371 1:232692538-232692560 AGAGGAAAGAGGAAGCAGGAGGG + Intergenic
923319474 1:232816409-232816431 AATGGTATCAGGAAGAAGGACGG - Intergenic
923380671 1:233414690-233414712 TGTGGGAAGAGGAAGGCAGAAGG + Intergenic
923464699 1:234237811-234237833 ACTGCTATGAGGTAGGAGGAAGG - Intronic
923482423 1:234397407-234397429 AGGGGGAAGAGGGGGGAGGAGGG + Intronic
923482433 1:234397426-234397448 AGGGGGAAGAGGGGGGAGGAGGG + Intronic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923601693 1:235409241-235409263 ATTGGTAGGCAGAAGGAGGAAGG + Intronic
923711471 1:236390901-236390923 GGTGGTAAGTGGTAGAAGGAAGG - Intronic
924043998 1:240009809-240009831 AGTGGTAAGAAGGAGGAGCTGGG - Intergenic
924055185 1:240118125-240118147 AGTGGTGAGAGGTGGGAGGTAGG + Intronic
924247228 1:242096885-242096907 AGGGGGAGGGGGAAGGAGGAGGG - Intronic
924527252 1:244863655-244863677 GGAGGTAAGAAGAAGGCGGAAGG - Exonic
924628757 1:245717126-245717148 AGAGAAAAGAGGAGGGAGGAAGG + Intergenic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063440794 10:6071423-6071445 TGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1063482143 10:6385325-6385347 AGTGGGAGGAGGAGGGAGGTGGG - Intergenic
1063691815 10:8295123-8295145 AGTGGGAAGAAGAAGGAAGCTGG + Intergenic
1063761678 10:9085810-9085832 AGTGTAAAAAGGATGGAGGAAGG - Intergenic
1063938942 10:11107803-11107825 AGGGGGAAGAAGAGGGAGGAGGG - Intronic
1063938949 10:11107822-11107844 AGGGGGCAGAGGAGGGAGGAGGG - Intronic
1064563180 10:16612883-16612905 AGGGGGAAGAGGAGGGGGGAAGG - Intronic
1064581377 10:16796412-16796434 AGTGTTGAGAGAAAGGTGGAGGG - Intronic
1064612536 10:17118084-17118106 AGTGATAATAGCAAGGATGAAGG - Intronic
1064622290 10:17228850-17228872 AGCGGGAAGAGGAAAGAGTAAGG - Intronic
1065027488 10:21552862-21552884 AGAAGAAAGAGGGAGGAGGAAGG - Intronic
1065362889 10:24905881-24905903 AGTGGTGAGAGGAGGGAGCGGGG - Intronic
1065499242 10:26362861-26362883 TGTGGGAAGAGGAGGGAGAAAGG + Intergenic
1065614854 10:27510001-27510023 GGTGGTGAGAGGAAGGTAGAAGG - Intronic
1065808237 10:29415483-29415505 CGTGGTAAGAGGAAGGTAGAAGG - Intergenic
1066143930 10:32536652-32536674 AGTGGAGAGTGGTAGGAGGAAGG - Intronic
1066586638 10:36943612-36943634 AGAGGACAGAGGAAGGTGGAAGG + Intergenic
1067045512 10:42983082-42983104 GGTGTTTAGAGGAGGGAGGAGGG - Intergenic
1067048809 10:43000471-43000493 AGGGGCAAGTGGAAGAAGGACGG + Intergenic
1067914658 10:50384425-50384447 AGAGGAAAGAGGGAGGAAGAGGG - Intronic
1068068062 10:52157797-52157819 AAAGGAAAGAGGAAGGAAGAAGG - Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068174006 10:53433494-53433516 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1068273378 10:54759070-54759092 AGTAGTAAGATGGAGGGGGAGGG - Intronic
1068638811 10:59378748-59378770 AGGGGAAGGAGGAAGGAGAAAGG - Intergenic
1068734661 10:60399378-60399400 CGTGGTGGGAGGGAGGAGGATGG - Intronic
1068827682 10:61457317-61457339 GGTGGAATGAGGAAGGAAGAAGG - Intergenic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069622775 10:69848002-69848024 GCTGGGAAGAGGAAGGAGGTGGG - Intronic
1069708953 10:70477195-70477217 TGTGGCAAGAGGAAGAAGGAAGG + Intergenic
1069869337 10:71523677-71523699 ACTGGTGAGGGGCAGGAGGAGGG + Intronic
1069936316 10:71919756-71919778 AAAGGTAAGAGGCAGGAGAATGG - Intergenic
1069938629 10:71937693-71937715 AGTGGGTAGGGGAGGGAGGAAGG - Intergenic
1069984250 10:72273165-72273187 AGTGGTTAGAGGAGTGTGGATGG - Intergenic
1070041536 10:72785320-72785342 AGTGGTAGGGGGCAGCAGGAGGG - Intronic
1070364558 10:75723690-75723712 AGTGGCAAGAGCAGGCAGGATGG + Intronic
1070705598 10:78635693-78635715 GGAGGTAAGAGCCAGGAGGATGG - Intergenic
1071047511 10:81400184-81400206 AGTGGGAAGAAAAGGGAGGAAGG + Intergenic
1071124257 10:82315976-82315998 AGTCGCAATAGGAAGGATGAGGG + Intronic
1071257691 10:83887424-83887446 AGTGATAAAAGGAATGAGGGTGG + Intergenic
1071663004 10:87524743-87524765 AGAGGAAAGAGGATGGAGAATGG + Intronic
1072085632 10:92076762-92076784 AGAAGGAAGAAGAAGGAGGAAGG + Intronic
1072571768 10:96664382-96664404 AATGGTAGAAGGAAGGAGGGAGG - Intronic
1073037131 10:100571927-100571949 GGTGGTCAGAGATAGGAGGAAGG + Intergenic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073327494 10:102651094-102651116 AGCAGGAAGAGGAAGGAGGCTGG - Intronic
1073539228 10:104304843-104304865 TGGGGTGAGAGGGAGGAGGACGG - Intronic
1073597718 10:104817400-104817422 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1073632466 10:105162324-105162346 AGTGGTATGATGAGAGAGGAGGG - Intronic
1073671178 10:105591808-105591830 AGGGTGAGGAGGAAGGAGGAGGG + Intergenic
1074498848 10:114004201-114004223 AGTGGTAAGAGAAGACAGGATGG - Intergenic
1074603860 10:114941063-114941085 AGTGGACAGAGAAGGGAGGAGGG - Intronic
1074984117 10:118642217-118642239 ACTGCTAAGAGGAAGGGAGATGG + Intergenic
1075396367 10:122130582-122130604 AGGTGGAAGAGGAAGGAAGAGGG - Intronic
1075416066 10:122265351-122265373 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1075561861 10:123473951-123473973 TGTGGAAAGAGGAAAGGGGAAGG - Intergenic
1075931488 10:126300397-126300419 TTTGGTAAGGGGAAGAAGGAAGG - Intronic
1076171277 10:128322243-128322265 CGTGGGAACAGGAAGGTGGAAGG + Intergenic
1076428813 10:130387473-130387495 AGAGGGAAGAGGAGGGAGGACGG + Intergenic
1076915412 10:133420986-133421008 AGAGGGAAGAGGAAGGAAGGTGG + Exonic
1077013474 11:390104-390126 AGGGGTCAAGGGAAGGAGGATGG + Intergenic
1077307179 11:1873636-1873658 AATGGAAGGAGGAGGGAGGAGGG + Intronic
1077483864 11:2830032-2830054 GGAGGGAGGAGGAAGGAGGAGGG + Intronic
1077838264 11:5944384-5944406 AGTTGCAAGAGGAAGGAAGAGGG + Intergenic
1077885558 11:6385054-6385076 AGTAGGAAAAGGAGGGAGGAGGG - Intergenic
1077901352 11:6491792-6491814 ATTGGTAACAGTAAGGAGGGAGG + Intronic
1078229299 11:9424973-9424995 TGTAGTAAGAGGAAAGAGGTAGG + Exonic
1078384114 11:10872763-10872785 AGGGGTAAGGGGAAGGGGAAGGG - Intergenic
1078451632 11:11444684-11444706 AGAGGTGAGAGAAAGGAGGGTGG + Intronic
1078475955 11:11630351-11630373 AGTGGGAAGAGGCAAGAGGAAGG - Intergenic
1078704304 11:13724624-13724646 AGTGGGAAGAGAAAGGAAGCTGG - Intronic
1078877794 11:15415462-15415484 AGTGGGAGGAGAAGGGAGGAGGG + Intergenic
1079138753 11:17793537-17793559 AGAAGTAAGAGGAAGGAGAGTGG + Intronic
1079392986 11:20038542-20038564 CGTGATATGAGGGAGGAGGATGG - Intronic
1079907853 11:26270987-26271009 AGTGGTAGAAGGTAGGAGGGAGG + Intergenic
1080181307 11:29429616-29429638 AGTGGTAAAAGTAAGCACGATGG + Intergenic
1080376995 11:31724223-31724245 ACTGGGAAGAGGAAGGATGTGGG + Intronic
1080438550 11:32268940-32268962 AATGGGAAGGGGAAGGGGGAGGG + Intergenic
1080862750 11:36164073-36164095 AGTGGTAAGAGGCTGGAAAATGG - Intronic
1080979959 11:37390313-37390335 AGTGAGAAAAGGGAGGAGGAGGG + Intergenic
1081229312 11:40564837-40564859 ACTGGCAAGAGATAGGAGGACGG + Intronic
1081456849 11:43232043-43232065 AGTGGGAACAGGAAGGAGTGAGG - Intergenic
1081574461 11:44310491-44310513 AGTGGAAGGAGAGAGGAGGAGGG - Intergenic
1081787542 11:45757829-45757851 CGTGGGAAGAGGATGGAGGGAGG + Intergenic
1081906350 11:46672785-46672807 AGTGCCAGGAGGAAGAAGGAAGG + Intronic
1081988094 11:47321769-47321791 AGAGGGAAGAGGAAGGAGTCGGG + Intronic
1082196804 11:49316264-49316286 AGGGGTAAGGGGAAGGGGAAGGG + Intergenic
1082209685 11:49483712-49483734 GGTGGTCAGAGCAAGGAGAATGG - Intergenic
1082242079 11:49884266-49884288 AGTGGTCAGAGTATGGAGTAGGG + Intergenic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082805974 11:57450744-57450766 AGTGGTAAGAGAAAGGACTTTGG + Intergenic
1082849297 11:57751658-57751680 AGTGGTAATGGAAATGAGGAAGG - Exonic
1082892401 11:58154095-58154117 AAGGGGAGGAGGAAGGAGGAGGG + Intronic
1083162785 11:60865590-60865612 GAGGGTAAGAGGAAGGAGAAGGG - Intergenic
1083328812 11:61887365-61887387 AAGGGTAAGAGAAGGGAGGATGG - Intronic
1083739327 11:64700134-64700156 AGAAGTAAGAGGAATGTGGAGGG - Intronic
1083900303 11:65640371-65640393 AGTGGGAGGGGCAAGGAGGAAGG + Intronic
1083903486 11:65655126-65655148 TGGGGTAAGAGGAAGGAGATAGG - Intronic
1084208855 11:67611691-67611713 AGGTGGAAGAGGAGGGAGGAAGG + Intronic
1084264194 11:67996454-67996476 AGAGGGAAGAGAAAGCAGGAGGG + Intronic
1084520129 11:69657744-69657766 AGGGGACAGAGGAAGGAGGCTGG + Intronic
1084865502 11:72052938-72052960 AATGGTAAGACACAGGAGGAAGG + Intronic
1084945151 11:72634316-72634338 TGTGGGAAGAGGAAGACGGAGGG + Intronic
1085014112 11:73161297-73161319 AGGGGTAGGAGGAAGGGGAATGG - Intergenic
1085298984 11:75447651-75447673 AGTGGTATGCTGAAGCAGGAAGG - Intronic
1085502660 11:77037978-77038000 AGGGGGAAGAGGGAGGAGGAGGG + Intronic
1085891399 11:80584393-80584415 AGAGGCGAGGGGAAGGAGGAAGG + Intergenic
1086260180 11:84930545-84930567 AGTGGAATGAGGATGGAGGAAGG - Intronic
1086338435 11:85823067-85823089 GGTGGCAAGAGGGAGGAGGCTGG - Intergenic
1086472084 11:87124792-87124814 AGGGGAAAAAGGAGGGAGGAAGG - Intronic
1086639990 11:89141824-89141846 GGTGGTCAGAGCAAGGAGAATGG + Intergenic
1086991849 11:93312395-93312417 AGTGGGGAGAGAAAGTAGGATGG + Intergenic
1087054460 11:93919999-93920021 AGTGGTGGGAGGATGGAGGGTGG + Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087365802 11:97217400-97217422 AGGGGAAAGTGGAAGCAGGATGG - Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089340583 11:117754695-117754717 AGTCATATGGGGAAGGAGGAGGG + Intronic
1089368192 11:117933942-117933964 AGAGGAAAGAGGAGGGAGAAAGG + Intergenic
1089384144 11:118057025-118057047 AGTGGTGAGGGGAAGGAAGAAGG + Intergenic
1089386630 11:118072593-118072615 AGGGAGGAGAGGAAGGAGGAAGG + Intergenic
1089506912 11:118969520-118969542 AGAGGGAAGAGAAGGGAGGAGGG + Intergenic
1089562412 11:119350677-119350699 GGTGGCAAGAGGAGGGAGGTAGG + Intergenic
1089618356 11:119707931-119707953 AGTGGCAAGAGGAAGGAGCGTGG + Intronic
1089715219 11:120352934-120352956 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1089977484 11:122745054-122745076 AGTGGCAAAAGCAAGGAGCAGGG + Intronic
1090023960 11:123151944-123151966 AGAGGGAAGAGGAAGGAGGCAGG - Intronic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1090602872 11:128390863-128390885 TTTGGCAAGAGAAAGGAGGAAGG - Intergenic
1090738928 11:129639106-129639128 ACTTGTATGAGGAAGGAGGAAGG - Intergenic
1091057213 11:132430286-132430308 AGGGGGAAGAGGAGGGAGGTGGG + Intronic
1091193224 11:133711630-133711652 AGTGCTAAGAGCAGGGAGGATGG - Intergenic
1091398553 12:169266-169288 AGTGGTGGGAGTGAGGAGGAAGG + Intronic
1091441272 12:512894-512916 GGTGGAAAGCGGAAGGCGGAAGG - Intronic
1091441286 12:512953-512975 GGTGGAAAGTGGAAGGTGGAAGG - Intronic
1091441345 12:513194-513216 AGTGGAAGGTGGAAGGTGGAAGG - Intronic
1091749711 12:3014760-3014782 AGGGGTCAGAGGAAGTGGGAAGG - Intronic
1092246815 12:6868358-6868380 GGTGGAGGGAGGAAGGAGGATGG - Intronic
1092312531 12:7374025-7374047 AGAGGAAAGAGGGATGAGGAAGG - Intronic
1092490063 12:8936977-8936999 AGTGCTGAGGGCAAGGAGGAGGG - Intronic
1093564883 12:20590306-20590328 AGGGGTCAGAGGAAGTTGGAAGG - Intronic
1093669988 12:21862382-21862404 AGAGGCAAGAGGAAGGGGGAGGG - Intronic
1093696245 12:22163744-22163766 AGTGGGCAGAGGCAGGAGGCAGG + Intronic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094130073 12:27065057-27065079 AGTGGTAGGAGAAAGCAGAATGG + Intronic
1094183455 12:27616114-27616136 AGGGAAAAGAGGAGGGAGGAAGG - Intronic
1094702522 12:32883925-32883947 AGGGGTGAGAGGAAGGCGTAAGG - Intronic
1095131795 12:38551242-38551264 AATAGTAAGAGGAAGGGAGAAGG - Intergenic
1095299709 12:40569451-40569473 AGAAGTAAGAGGAAGGGAGAAGG - Intronic
1095650828 12:44607024-44607046 AGTGATAGGAGGGAGGAGGTGGG - Intronic
1095991204 12:48035801-48035823 AGTGATAGGAGGAATGAGGAAGG - Intergenic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096087343 12:48874624-48874646 AGTGGCAAGAGAAGGCAGGAAGG - Intergenic
1096240486 12:49957302-49957324 GGTGGTAGGAGGAAGGAGGTGGG - Exonic
1096311611 12:50525927-50525949 AGTGGTGAGATGAAGAATGATGG - Intronic
1096458513 12:51807362-51807384 AGCGGGCAGAGGAAGGAAGAAGG + Exonic
1096469889 12:51869327-51869349 TGGGGGAAGAGGAGGGAGGAGGG + Intergenic
1096598382 12:52712508-52712530 TGTGGTAGGGGGAGGGAGGAGGG + Intergenic
1096675702 12:53224713-53224735 AGTGGCAGGAGGAGGGAGGAGGG - Intronic
1096732455 12:53625740-53625762 AAGGGTAATAGGAAGGAGGTAGG - Intronic
1097085784 12:56467255-56467277 AGGGGTAGGAGGATGGAGGTGGG + Intronic
1097834134 12:64256661-64256683 AGTAGAAAGAGGAAAGAGAAGGG + Intergenic
1097950033 12:65417638-65417660 AAGGGTAAGAGGAAGGAGTTTGG - Intronic
1098074548 12:66715029-66715051 AGTGGGCATAGGAAGGAGAAGGG - Intronic
1098169688 12:67734421-67734443 ACTATTAAGAGGAAGGAGGGAGG - Intergenic
1098707790 12:73713322-73713344 AATGGGAAGAGGAAGGTGGTGGG - Intergenic
1098980801 12:76953545-76953567 AGTGGTAGGAGGCAGGTGGATGG - Intergenic
1099070632 12:78042057-78042079 AGTGAAAACAGAAAGGAGGAGGG - Intronic
1099796519 12:87407943-87407965 AGTGATAAGAGGATGGGAGAGGG - Intergenic
1100292681 12:93232697-93232719 AGTGCCAGAAGGAAGGAGGATGG - Intergenic
1100294528 12:93248513-93248535 AGTAGTGAAAGGAATGAGGATGG + Intergenic
1100372472 12:93980865-93980887 AGGGGAAAAAGGGAGGAGGAAGG + Intergenic
1100450014 12:94696612-94696634 GGTGGGAAGAGGAAGAAGGAGGG + Intergenic
1101162648 12:101994546-101994568 AGTGGGAAGAGGAGAAAGGATGG - Intronic
1101427681 12:104601119-104601141 GGAGGGAGGAGGAAGGAGGAAGG - Intronic
1102230383 12:111257682-111257704 AGGAGGAAGGGGAAGGAGGAGGG - Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102465659 12:113129660-113129682 TGTGGTGAAAGGAGGGAGGAAGG - Intronic
1102796157 12:115690556-115690578 AGTGGAAGTAGGAAGAAGGAAGG + Intergenic
1102866986 12:116382313-116382335 AGAAGGAAGAGGAAGGAGGAGGG + Intergenic
1103147580 12:118609016-118609038 AGTGGGGAGAGAAAGGAGGTAGG + Intergenic
1103219472 12:119231874-119231896 AGGGGGAGGAGGGAGGAGGAAGG - Intergenic
1103763991 12:123269294-123269316 AGGGCTGAGAGGGAGGAGGAAGG + Intronic
1103834796 12:123809983-123810005 AGTGGTACGTGGTAGGAAGATGG - Intronic
1104295494 12:127508151-127508173 ATGGGTAGGAGGATGGAGGATGG + Intergenic
1104353290 12:128063571-128063593 AGTTGCAAGTGGAAGGAGGCAGG - Intergenic
1104500954 12:129284904-129284926 AGGGGTAAGGGGAAGGAGTGGGG + Intronic
1104508852 12:129357465-129357487 AGTAGAAAAAGGAAGGAGGAAGG + Intronic
1104792093 12:131489741-131489763 ACTGGTAAGAGAAGGGAGAATGG + Intergenic
1104835241 12:131786059-131786081 AATGGGCAGAGGCAGGAGGAAGG + Intronic
1104943887 12:132407187-132407209 GGAGGTAAGAGGAGGGAGGTGGG - Intergenic
1105705077 13:22963443-22963465 AGGGTTAAAAGGAAGGAGGGAGG + Intergenic
1105764590 13:23546918-23546940 AGGGGAGAGAGGAGGGAGGAAGG - Intergenic
1105778139 13:23681688-23681710 AGGGGAAAGAGCAAGCAGGAGGG - Intergenic
1105998638 13:25697607-25697629 AATAGTAAGAGGAAGAAGAATGG + Intronic
1106322592 13:28656013-28656035 AGAGCTAGGAGGAGGGAGGAGGG + Intergenic
1106482755 13:30149107-30149129 AATGGGAAGAGGCAGGCGGATGG + Intergenic
1106487580 13:30185840-30185862 AGTTGCAAGAGGAAGGAGCTGGG + Intergenic
1106694871 13:32162593-32162615 AGTGGTGTCAGGAAGGAGGAAGG - Intronic
1106787771 13:33124173-33124195 GGTGGTAATAGGAAGGAAAAGGG - Intronic
1106849601 13:33775320-33775342 AGAGGAAAGAGCAAGCAGGAGGG - Intergenic
1108331688 13:49391316-49391338 AGGGGGAAGAGAAAGGAAGATGG + Intronic
1108575080 13:51783646-51783668 AGTGGCTAGGGGCAGGAGGAGGG - Intronic
1108961025 13:56229730-56229752 AGTGGTAGGTTGAAGGAGCAAGG + Intergenic
1109292321 13:60491653-60491675 CATGTTAAGAGGAATGAGGATGG - Intronic
1109373667 13:61459329-61459351 AGTGGTAAAAGAGATGAGGATGG - Intergenic
1110411932 13:75214294-75214316 AGAGGGATGAGGAATGAGGAGGG - Intergenic
1110413886 13:75231645-75231667 AGTGGTATGGTGCAGGAGGAGGG + Intergenic
1110828485 13:80001431-80001453 AGTGGTTAGATAAAGCAGGATGG + Intergenic
1111086425 13:83380715-83380737 AGTGGGAGGAGGAGGAAGGAAGG - Intergenic
1112062281 13:95753078-95753100 GGAGGGAAGAAGAAGGAGGATGG - Intronic
1112423910 13:99279083-99279105 GGTGGGAAAAGGAAGGAGAAAGG - Intronic
1112513025 13:100026834-100026856 AGTTGGAAGGGGAAGCAGGAGGG - Intergenic
1112734641 13:102402329-102402351 AAGAGTGAGAGGAAGGAGGAAGG - Intergenic
1112760295 13:102687876-102687898 AAAGGTTAGAGGAAGGTGGAGGG - Intronic
1112947028 13:104941544-104941566 AATGGTGAGAGAAAGCAGGAGGG + Intergenic
1113115392 13:106869636-106869658 ATTGGCAAGAGGCAGGAGAAAGG + Intergenic
1113119294 13:106909142-106909164 AGTCCTAAGAGGTAGGAGGGAGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113195613 13:107801828-107801850 AGAGGAAAGGGGAAGGAAGAAGG - Intronic
1113582659 13:111440000-111440022 AGGGGTCAGAGGGAGGTGGATGG + Intergenic
1113909669 13:113836226-113836248 AGTGGGAGGAGGAAGGGGGGAGG + Intronic
1114378370 14:22173831-22173853 AGGTGTAAGAGCAAGCAGGAGGG + Intergenic
1114587083 14:23825146-23825168 AGGTGTAAGAGGAAGCAGGAGGG + Intergenic
1114689961 14:24572335-24572357 AGGGGAAAGAGCAAGCAGGAAGG + Intergenic
1115741110 14:36389952-36389974 AGTCTAATGAGGAAGGAGGATGG - Intergenic
1115776792 14:36724322-36724344 AGGGGTATGGGGAAGGAGGGGGG - Intronic
1116116053 14:40652418-40652440 AAAGGAAAAAGGAAGGAGGAAGG - Intergenic
1116779132 14:49216528-49216550 ATTGGTCAGAGGAAGGAATAAGG + Intergenic
1117236217 14:53779616-53779638 AGTGGTCAGCAGAAGGAGAATGG + Intergenic
1117876188 14:60251834-60251856 ACTCTTGAGAGGAAGGAGGATGG + Intronic
1118125360 14:62896470-62896492 CATGGTAAGAGGAAGGTGAAAGG - Intronic
1118171785 14:63395737-63395759 AGAGGGAAAAGGGAGGAGGAGGG + Intronic
1118980984 14:70716813-70716835 GGTTGTAGGAGGAAGGAGGGAGG + Intergenic
1119093017 14:71801856-71801878 AGGAGTAAAAGGAAGGAGAAAGG + Intergenic
1119112695 14:71989865-71989887 TGTGGTAATAGGAAAGAGAAAGG - Intronic
1119186888 14:72649471-72649493 AGTGAGAAGAGGAAGAAGGAAGG + Intronic
1119203066 14:72772912-72772934 TGTGGGAAGAAGAAGTAGGAAGG + Intronic
1119757311 14:77128230-77128252 AGTGATCAGAGGAAGGAGGCAGG + Intronic
1119783081 14:77291400-77291422 GGAGGGAAGAGGAAGCAGGAGGG + Intronic
1119898563 14:78241265-78241287 AGTGGGAAGGGACAGGAGGAGGG - Intergenic
1119997651 14:79271382-79271404 AGGGGAAGGAAGAAGGAGGAAGG - Intronic
1120470516 14:84918057-84918079 AGGAGGAGGAGGAAGGAGGAGGG - Intergenic
1120573196 14:86147542-86147564 AGTTCTAAGAGTAAGGAAGAAGG + Intergenic
1120835449 14:89035137-89035159 TGAGGTCAGAGGAAGGTGGAGGG - Intergenic
1121505243 14:94472228-94472250 AGTGGGAAGAGAAGGGAGGGAGG - Intronic
1121652076 14:95566117-95566139 AGAGGAAAGGGGAAGGAGGAAGG + Intergenic
1121743002 14:96267157-96267179 AGAGGGAAGAAGAAGGAGGTTGG + Intronic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1122091416 14:99343420-99343442 GGTGGGAAGAGGTGGGAGGAGGG - Intergenic
1122409706 14:101519639-101519661 ACCCGTAAGAGGAAGGAGGGCGG + Intergenic
1122942518 14:104988245-104988267 AGTGTGAAGGGGTAGGAGGAGGG - Intronic
1123144298 14:106112997-106113019 AGGGGTGGGAGGAAGGGGGAGGG + Intergenic
1202828337 14_GL000009v2_random:1029-1051 AGTAATAAAAGGAAGGAGGGTGG - Intergenic
1124343415 15:28904584-28904606 AGAGGGAAAAGGAAGGAAGAGGG - Intronic
1125005784 15:34815216-34815238 AGTGGTAATAGCAATGAGAATGG + Intergenic
1125181083 15:36881239-36881261 AGTGCTGATAGGGAGGAGGAGGG - Intergenic
1125646485 15:41276979-41277001 TGAGGTAAGAAGAATGAGGAAGG + Intronic
1125833652 15:42733016-42733038 GGTGGCAGGAGGGAGGAGGAGGG - Intronic
1126407549 15:48336917-48336939 AGTGGAAAGAACAAGGAGGCTGG - Intronic
1126567419 15:50114552-50114574 AGTGAGAAGAGGAAGGAAGATGG - Intronic
1126573837 15:50179055-50179077 AGTAGAAAGAGGAAGGTGCAGGG + Intronic
1127691060 15:61398384-61398406 AGTGGGAGGAGGAAGAAGGTAGG + Intergenic
1128435780 15:67646106-67646128 AGTGGTAAGAAGAAGGAGGTGGG + Intronic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128547962 15:68579985-68580007 AGAGTTAAGAGGAAAGATGATGG + Intronic
1128726888 15:69994595-69994617 AGAGGAAAGAGGAAGGACAAAGG - Intergenic
1129044877 15:72725761-72725783 AAGGGGAAGAGGAAGGGGGAAGG - Intronic
1129044968 15:72725948-72725970 AGGGGGAAGGGAAAGGAGGAAGG - Intronic
1129197834 15:73981749-73981771 GGTGTGAAGAGGGAGGAGGAGGG - Exonic
1129344788 15:74910284-74910306 AGTAGTAGGAGCAAGGAAGAGGG - Intergenic
1129451503 15:75653627-75653649 AGGCGAAAGAGGAGGGAGGAAGG + Intronic
1129694507 15:77733056-77733078 ACTGGAAACAGGAAGGAGGGTGG - Intronic
1129727928 15:77911049-77911071 ATAGGACAGAGGAAGGAGGAGGG - Intergenic
1129839951 15:78737811-78737833 ATAGGACAGAGGAAGGAGGAGGG + Intergenic
1130615113 15:85398948-85398970 AGAGGAAAGAGGCAGGAGGAAGG - Intronic
1130717380 15:86348477-86348499 GGTGGTAAGAATAGGGAGGAGGG + Intronic
1131014154 15:89043513-89043535 AGGAGGAAGAGGAGGGAGGAGGG + Intergenic
1131252553 15:90839918-90839940 AGTGGTAAAGGGAAGGAAAATGG - Intergenic
1131649868 15:94387115-94387137 GGAGGAAGGAGGAAGGAGGAAGG - Intronic
1131649870 15:94387122-94387144 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
1131934609 15:97489678-97489700 AGTGGAGTGAGCAAGGAGGAAGG - Intergenic
1131978118 15:97966089-97966111 ACTGTTGAAAGGAAGGAGGAAGG - Intronic
1132386640 15:101405421-101405443 AGTGTTGAGTGGAAGGAAGATGG + Intronic
1132535044 16:474627-474649 AGTGGGAGAAGGAGGGAGGACGG - Intronic
1132630397 16:914533-914555 AGTGGTCATGGGAAGGAGGGAGG - Intronic
1132802483 16:1761200-1761222 TGTGGGAAGGGGAAGGAGGCAGG - Intronic
1132846185 16:2001915-2001937 AGTGGGAAGGGAGAGGAGGAGGG + Intronic
1133105542 16:3506300-3506322 AGAGGTAAGAGGAGAGAGCACGG - Intronic
1133392643 16:5422404-5422426 CGTAGGGAGAGGAAGGAGGAGGG + Intergenic
1133392851 16:5423083-5423105 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1133582615 16:7160827-7160849 AGGAGGAGGAGGAAGGAGGAGGG - Intronic
1134049083 16:11124414-11124436 ACTGGGAAGGGGAAGGAGGAAGG - Intronic
1134260213 16:12645137-12645159 AATGGTGAGAGGAAGGGGGATGG - Intergenic
1134413210 16:14020719-14020741 ATTGGCAACAGGAAGGAGAATGG - Intergenic
1134692152 16:16197942-16197964 GGTGGGAGGGGGAAGGAGGAGGG + Intronic
1135066540 16:19314905-19314927 AGAAGGGAGAGGAAGGAGGAGGG + Intronic
1135066561 16:19314976-19314998 AGAAGAGAGAGGAAGGAGGAGGG + Intronic
1135315768 16:21443269-21443291 ACTGGTCAGAGGAAGGGAGATGG + Intronic
1135368694 16:21875530-21875552 ACTGGTCAGAGGAAGGGAGATGG + Intronic
1135443123 16:22495612-22495634 ACTGGTCAGAGGAAGGGAGATGG - Intronic
1135501370 16:22998886-22998908 AGTGATAAGTGGAAAGAGAAAGG + Intergenic
1135562910 16:23490088-23490110 AGTGGCAAGAACAAGGAGAAAGG + Intronic
1135584110 16:23654746-23654768 AAAGGTAGGAGGAAGGAAGAGGG - Intronic
1135938748 16:26803037-26803059 GAAGGAAAGAGGAAGGAGGAAGG + Intergenic
1136043785 16:27600195-27600217 AGTGGGGTGAGGAGGGAGGAGGG + Intronic
1136312451 16:29422019-29422041 ACTGGTCAGAGGAAGGGAGATGG + Intergenic
1136325877 16:29523750-29523772 ACTGGTCAGAGGAAGGGAGATGG + Intergenic
1136440566 16:30263733-30263755 ACTGGTCAGAGGAAGGGAGATGG + Intergenic
1137012756 16:35339848-35339870 AGTGGGAACAGGAAAGATGAGGG + Intergenic
1137238563 16:46635324-46635346 GTTGGGAACAGGAAGGAGGAAGG + Intergenic
1137821527 16:51449922-51449944 AGTGAGAAGAGAAAGCAGGAAGG - Intergenic
1137844563 16:51674579-51674601 AGCTGGAAGAGGCAGGAGGAAGG - Intergenic
1137928138 16:52561446-52561468 AGTGGCAAAAGGATGGTGGATGG - Intergenic
1139033011 16:62908136-62908158 AGAGAAGAGAGGAAGGAGGATGG + Intergenic
1139180176 16:64737863-64737885 TATGGTAAGAGGAAGGAAGCAGG - Intergenic
1139272423 16:65696722-65696744 AGAGGAAAGAGAAAGAAGGAGGG + Intergenic
1139443082 16:66978823-66978845 AGTAGTGTGAGGCAGGAGGATGG + Intergenic
1139524571 16:67506571-67506593 AGAGGAAAGAGGCAGCAGGAGGG + Intergenic
1139887080 16:70216070-70216092 ACTGGTCAGAGGAAGGGAGATGG + Intergenic
1140143597 16:72284405-72284427 AGGGGTTGGAGGAAGGAGTAGGG - Intergenic
1140375380 16:74441344-74441366 ACTGTCAAGAAGAAGGAGGAAGG - Intergenic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141372442 16:83500480-83500502 AGGGGGAGGAGGAGGGAGGAAGG - Intronic
1141516638 16:84549233-84549255 AGAGGCAGGAGGATGGAGGAAGG + Intronic
1142105146 16:88298696-88298718 AGTGGGGAGAGGAAGGTGGGAGG - Intergenic
1142545321 17:697621-697643 AGTGGCATCAGGCAGGAGGAGGG + Intronic
1142621636 17:1169100-1169122 AGGGGAAAGAGGAGGGAGGGAGG + Intronic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143294838 17:5863208-5863230 AAAGGAAAAAGGAAGGAGGAAGG - Intronic
1143434392 17:6912930-6912952 AGTGATAAGAGGAAAGAGAGAGG - Intronic
1143599401 17:7934282-7934304 AGTGGACAGAGGAAGCAGGCAGG + Intronic
1144039530 17:11397301-11397323 ACTGGAAAGAGAAAGGAGGCAGG - Intronic
1144122705 17:12171496-12171518 AGTGGTTGGGGGAAGAAGGAAGG - Intergenic
1144196754 17:12902010-12902032 GAAGGGAAGAGGAAGGAGGAGGG - Intronic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1145004531 17:19329951-19329973 AGTGGAAATTGGCAGGAGGAGGG - Intronic
1145228624 17:21152915-21152937 AGTGGTAAGGTGCTGGAGGAAGG - Intronic
1145835723 17:27952915-27952937 GGTGGTGAGAGGAGAGAGGAAGG + Intergenic
1145898274 17:28473532-28473554 GGAGGTGAGAGTAAGGAGGAGGG - Exonic
1145969579 17:28949308-28949330 GGAGGGAAGAGGGAGGAGGAAGG + Intronic
1146255924 17:31391617-31391639 AGTGGGGAGGGGAAGGAGGAGGG - Exonic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1146937957 17:36824236-36824258 AGTCGGCGGAGGAAGGAGGAAGG - Intergenic
1146962325 17:36993263-36993285 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1147033427 17:37660688-37660710 AGTGGAAAGTGGAAAGAGCATGG + Intergenic
1147139968 17:38455343-38455365 AGTTGGAAGAGGTGGGAGGAAGG + Intronic
1147645831 17:42033286-42033308 AGTGGTAAGATGTAGTAGAAAGG + Intronic
1147773838 17:42886474-42886496 AGAAGGAAGAGGAAAGAGGAAGG - Intergenic
1147856488 17:43484224-43484246 TGAGGGAAGCGGAAGGAGGAAGG + Intronic
1147856490 17:43484231-43484253 AGCGGAAGGAGGAAGGAGGAAGG + Intronic
1148066682 17:44876123-44876145 GGTGGTAAGAAGAACAAGGAGGG + Intronic
1148094617 17:45043808-45043830 AGTGGAAGGAGGGAGGAGGGAGG - Intronic
1148114707 17:45168986-45169008 AGAGGGAGGAGGAAGAAGGATGG - Intronic
1148136961 17:45299558-45299580 AGATGTCTGAGGAAGGAGGAAGG + Intronic
1148289809 17:46434936-46434958 AGAGGTAAGAGAAAGTAGCATGG - Intergenic
1148311977 17:46652508-46652530 AGAGGTAAGAGAAAGTAGCATGG - Intronic
1148326490 17:46786207-46786229 AGTGGAAACAGGAGGGAAGAGGG + Intronic
1148467564 17:47874023-47874045 AAGAGGAAGAGGAAGGAGGAGGG - Intergenic
1148482537 17:47969637-47969659 AGTGGGTAGAGTAAGGAGGGAGG - Intronic
1148645958 17:49219815-49219837 GGTATTAGGAGGAAGGAGGAAGG - Intronic
1148864060 17:50619464-50619486 AGAGGGAAGGCGAAGGAGGAAGG - Intronic
1148901894 17:50884781-50884803 GGTGGAAAGAGGAAGGGGGTGGG - Intergenic
1148988937 17:51648597-51648619 AGTGCAAAGTTGAAGGAGGAAGG - Intronic
1149501232 17:57154049-57154071 AGTGGTAGAAGGAAAGAGGAAGG - Intergenic
1149695015 17:58609948-58609970 AAGGGTAAGAGGAAGTAGGTGGG + Intronic
1150026796 17:61684412-61684434 AGGGGTAAAAGGGAAGAGGAAGG + Intronic
1150193609 17:63270809-63270831 GGTGGGAGGAGGTAGGAGGAGGG - Intronic
1150284100 17:63945800-63945822 GGTGGTAAGGGGGAGGGGGAGGG + Intronic
1150423614 17:65058959-65058981 AGAAGAAGGAGGAAGGAGGAAGG + Intergenic
1150465196 17:65386681-65386703 AAGAGAAAGAGGAAGGAGGATGG - Intergenic
1150557126 17:66264337-66264359 AATGGGAAGTGGAAGGAGCAAGG + Intergenic
1150841667 17:68613302-68613324 ATAGGGAAGAGGAAGAAGGAAGG - Intergenic
1150859454 17:68786342-68786364 AGGGGTGAGAGGAAGGAAGGAGG - Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151565599 17:74895980-74896002 AGTGGGAAAGGGAGGGAGGAGGG - Intergenic
1151979485 17:77500021-77500043 ACAGGTAACAGGAAGCAGGAAGG - Exonic
1152000071 17:77639872-77639894 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1152107118 17:78337005-78337027 ATTGGGGAGAGAAAGGAGGAAGG + Intergenic
1152261586 17:79270119-79270141 AATGGCAAAGGGAAGGAGGACGG - Intronic
1152367660 17:79865940-79865962 GGTGCTGAGAGGAAGGGGGAAGG + Intergenic
1152368919 17:79873019-79873041 ATTAGGAAGAGGAAGGAGGTCGG - Intergenic
1152386222 17:79976416-79976438 AGAGAGAAGAGGATGGAGGAAGG + Intronic
1152598436 17:81249448-81249470 GGAGGGAAGAGGAGGGAGGAGGG + Intronic
1152598454 17:81249509-81249531 GGAGGGAAGAGGAGGGAGGAAGG + Intronic
1152740423 17:82016174-82016196 AGAGGCCAGAGGAGGGAGGACGG + Intronic
1152970650 18:158431-158453 GGTGGCGAGAGGAGGGAGGAGGG - Intronic
1152985036 18:313423-313445 TGGCGTAAGAGGAAAGAGGAGGG + Intergenic
1153153888 18:2127363-2127385 TCTGCTAAAAGGAAGGAGGAAGG - Intergenic
1153718166 18:7872313-7872335 AGTGATATGAGGAAGTGGGAAGG - Intronic
1153912006 18:9712635-9712657 TGTGGCAAGAAGCAGGAGGAAGG + Intronic
1154275766 18:12958523-12958545 AGGGGGTAGAGGGAGGAGGAAGG - Intronic
1155066557 18:22273824-22273846 AGGGGGAGGAGGGAGGAGGAGGG - Intergenic
1155144067 18:23069082-23069104 AGGGGAAAGAGGAAGCAGGAGGG + Intergenic
1155162345 18:23206181-23206203 AGTGGGATGAGGAGCGAGGAGGG - Intronic
1155422742 18:25672779-25672801 AGTGATAACAGGGACGAGGATGG - Intergenic
1155574147 18:27226650-27226672 ATCGGCAAGAGGAAGGAGGTGGG - Intergenic
1155581626 18:27314623-27314645 TATTGTAAGAGGAAGGAAGAAGG + Intergenic
1155661062 18:28248795-28248817 ATAGGTAATTGGAAGGAGGAGGG + Intergenic
1155780446 18:29826024-29826046 AGTGGGTAGTGGAAGGAGGAGGG + Intergenic
1156201685 18:34839931-34839953 AGTGGTGAGGGCAAGGAGCATGG - Intronic
1156623276 18:38878482-38878504 AGTAGTAAGTGGTAGGAGGGAGG + Intergenic
1157029059 18:43882459-43882481 AGTGAGAAGAGGAAGGCTGATGG - Intergenic
1157095668 18:44683411-44683433 AGTGGGGAGAGGCAGGAGGCAGG + Intronic
1157520124 18:48339662-48339684 AGTGGGAATGGGAAGGAGGAGGG + Intronic
1157735476 18:50044876-50044898 AGGGGAAAGAGCAAGTAGGAGGG + Intronic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158622177 18:59042402-59042424 AGTGCTAAGAGGAGGAAGCAGGG - Intergenic
1159379813 18:67642345-67642367 AGAGCTAAGAGGAGTGAGGATGG + Intergenic
1159653382 18:71003710-71003732 AGTGGTGAGGGAAAGAAGGATGG - Intergenic
1159898266 18:74017663-74017685 TGAGGTTAGAGGAAGGAAGATGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160148385 18:76382222-76382244 AGTGGTATGAGAAAGGAGACTGG + Intronic
1160178630 18:76615851-76615873 GGTGCTAAGAGGTAGGAAGAGGG + Intergenic
1160452770 18:78977281-78977303 AGTGGGAAGATGGAGGAGGCCGG - Intergenic
1160872117 19:1282334-1282356 AGTGGGAAGGGGGAGGAGGGAGG + Intergenic
1160881410 19:1322360-1322382 AGTGGCAGGAGGCAGGTGGATGG + Intergenic
1161229405 19:3165545-3165567 AGAGGTAAGAGGAAGCTGGGTGG - Intergenic
1161357310 19:3826191-3826213 AGGGGAAAGAGGAATGAGCAGGG - Intronic
1161592972 19:5137013-5137035 TGTGGAAAGAGGACGCAGGAGGG - Intronic
1161756139 19:6135703-6135725 GGTGGTGGGAGGCAGGAGGATGG - Exonic
1161918740 19:7250353-7250375 AAGGGAAAGAGGAAGGAGGAGGG + Intronic
1161934568 19:7363755-7363777 ATTGATGAAAGGAAGGAGGATGG + Intronic
1162044413 19:7988994-7989016 GGTGGTCAGAGGACCGAGGAGGG + Intronic
1162136383 19:8557887-8557909 AGAGGTAGGAGGGAGAAGGAAGG - Intronic
1162182280 19:8878307-8878329 AGTGATAAATGGAAGGAGGAAGG - Intronic
1162194372 19:8972951-8972973 AGGGGGAAGTGGAAGAAGGATGG + Exonic
1162777836 19:12990420-12990442 AGCGGTAAGGGGCTGGAGGAAGG - Intergenic
1163159055 19:15454096-15454118 GGTGGGAACAGGAAGGAGCAGGG - Intronic
1163387241 19:17007379-17007401 AGAAGAAAGAAGAAGGAGGAAGG + Intronic
1163857688 19:19717793-19717815 AGTGGTAAGGTGTAGGTGGAAGG - Intronic
1164592319 19:29513575-29513597 AGGGGTATGAGGAGGAAGGAGGG + Intergenic
1164800680 19:31073683-31073705 AGTGGAGAAAGGAGGGAGGAAGG - Intergenic
1164805484 19:31113065-31113087 AGTGGAAGGGGGAAGGGGGAAGG + Intergenic
1164886202 19:31780585-31780607 AGAGGTCAGAGGAAGAGGGATGG + Intergenic
1165149820 19:33753865-33753887 AGTGGTAGGAGGATGGTGGGTGG - Intronic
1165386280 19:35512402-35512424 AGGGGTAAGAGGAAGGGGCTGGG - Exonic
1165387943 19:35522679-35522701 AGGGGAAAGAGGGAGAAGGATGG - Intergenic
1165468765 19:35990806-35990828 AGAAGGAGGAGGAAGGAGGAAGG + Intergenic
1165690890 19:37862389-37862411 AGGAGGAGGAGGAAGGAGGAGGG + Intergenic
1166169116 19:41014854-41014876 AGTAGGAAAAGGAAGGAGGAGGG + Intronic
1166558472 19:43716992-43717014 AGTGGGAAGAGGGAGGACCAGGG + Intronic
1166794976 19:45420514-45420536 TGTGGGAAGAGGTGGGAGGAGGG - Intronic
1167011857 19:46813776-46813798 AGGGGTTGGAGGGAGGAGGAGGG - Intergenic
1167326953 19:48832553-48832575 AGAGGTATGAGGCAGGATGAGGG + Intronic
1167421921 19:49409047-49409069 AGGGGTAGGAGGAGGCAGGAGGG + Intronic
1167489068 19:49781501-49781523 AGTGGTAGGAGGAAGGAGAGAGG + Intronic
1167521209 19:49956526-49956548 AGTGGGAATAGGAAGAAAGACGG - Intronic
1168019484 19:53598692-53598714 AGAGGCCAGAGGCAGGAGGATGG + Intergenic
1168048939 19:53814315-53814337 ACTGGTAACAGGGAGGAAGAAGG + Intronic
1168190074 19:54731745-54731767 TGAGGAAGGAGGAAGGAGGAAGG - Intronic
1168428352 19:56257581-56257603 AGTGGTAGGAGGTAGGAGCCAGG - Intronic
1168428383 19:56257725-56257747 AGTGGTAGGAGGCAGGAGCCAGG - Intronic
1168428453 19:56258086-56258108 AGTGGTAGGAGGCAGGAGCCAGG - Intronic
1168523179 19:57068823-57068845 AGTGGTAAGAGGAGGCTGGAGGG + Intergenic
1168599459 19:57706382-57706404 AGTGTTAAGTGGACAGAGGAAGG - Intronic
1202644362 1_KI270706v1_random:126791-126813 AGTAATAATAGGAAGGAGGGTGG + Intergenic
924979827 2:209621-209643 AGAGGTAAGAGGGGAGAGGAAGG - Intergenic
925654466 2:6131148-6131170 AGTGGAAAGATGAGGGTGGATGG - Intergenic
925947641 2:8880411-8880433 TGCGGGAGGAGGAAGGAGGAGGG + Intronic
926334486 2:11853040-11853062 AGGGGGAAGGGGAAGAAGGAAGG + Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926884183 2:17582221-17582243 AGGGGTGAGGGGAAGGAGGAAGG + Intronic
927335765 2:21922443-21922465 TTTGATAACAGGAAGGAGGAGGG - Intergenic
927631541 2:24778466-24778488 AGGGGTAGGAGGAAAGAGAAAGG + Intergenic
927668247 2:25046977-25046999 AGTGGTAGGTGGGAGGGGGAAGG - Intronic
927826874 2:26315473-26315495 GGAAGTAAGAGGAAGGAGAAAGG + Intronic
927869905 2:26616723-26616745 GGTAGGAGGAGGAAGGAGGATGG - Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928316446 2:30250288-30250310 GGTGGAAAGAGGAAAGAGGAAGG - Intronic
928533794 2:32219399-32219421 AGGGGGCAGAAGAAGGAGGAGGG - Intronic
928572324 2:32622098-32622120 AGAGGAAAGAGAAAGCAGGATGG - Intergenic
928958660 2:36898858-36898880 AGGAGTAGGAGGAAGAAGGAAGG + Intronic
929047479 2:37804131-37804153 TGGGGTCAGGGGAAGGAGGAAGG - Intergenic
929249552 2:39737906-39737928 GGTGGGAAGTGGAGGGAGGAGGG + Intronic
929444462 2:41991845-41991867 AGGGGAAGGAGGGAGGAGGAGGG + Intergenic
929952963 2:46430262-46430284 AGGGAGAAGAGGAAGGATGAAGG + Intronic
930430548 2:51270283-51270305 TGTGGTCAGAGGAAGGATGGTGG - Intergenic
930523850 2:52501493-52501515 AGAGTTCAGAGGCAGGAGGATGG + Intergenic
931364946 2:61611270-61611292 AAGGGTAAGAGAAAGGAAGAAGG + Intergenic
931400476 2:61926799-61926821 AGAGGAAAGAGCAAGCAGGAGGG - Intronic
931513147 2:63022276-63022298 GGAGGAAAGAGGAAGGAGGAAGG - Intronic
931590672 2:63880156-63880178 AGGGGTAGGGGGAAGGGGGAAGG - Intronic
931634281 2:64327811-64327833 AGTGGGGAAGGGAAGGAGGAAGG + Intergenic
931649215 2:64453914-64453936 CGTGGCAGGAGGAAGGAGGCTGG + Intergenic
931925151 2:67064446-67064468 AGTGGCCACAGGAAGAAGGAAGG - Intergenic
931995624 2:67836785-67836807 AGTTGGAAGAGGAACCAGGATGG - Intergenic
932044384 2:68332817-68332839 AGTGGTAAGATGAGGGAAGTTGG + Intergenic
932208138 2:69902192-69902214 GGAGGAAGGAGGAAGGAGGAAGG - Intronic
932208140 2:69902199-69902221 GGAGGGAGGAGGAAGGAGGAAGG - Intronic
932208160 2:69902281-69902303 AGAAGGAGGAGGAAGGAGGAAGG - Intronic
932983637 2:76699751-76699773 AGAGGAAAAAGGAAGGAAGAGGG - Intergenic
933177977 2:79197303-79197325 AGTGGTAAGGGGAAGCTGGAGGG + Intronic
934098591 2:88629551-88629573 AGAGGGAAGAGGAAGTAAGAGGG - Intergenic
934101075 2:88653606-88653628 GGAGGTAGGAGGAAGGAGTAAGG - Intergenic
934506737 2:94900334-94900356 AGTAATAACAGGAAGGAGGGTGG + Intergenic
934991444 2:98924700-98924722 AGGAGTAGGAGGAAGGAGGTGGG - Intronic
935587596 2:104815796-104815818 AGTGGTAAGAGGAGTGGGGATGG + Intergenic
936285454 2:111177926-111177948 GGTGAGATGAGGAAGGAGGAGGG - Intergenic
936341052 2:111633138-111633160 GGTGGTATGAGTGAGGAGGAGGG - Intergenic
936395561 2:112125630-112125652 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
936395564 2:112125637-112125659 AGAGGAAGGAGGGAGGAGGAGGG + Intergenic
936620634 2:114093718-114093740 AGTAGTAAGAAGTGGGAGGAGGG + Intergenic
936780882 2:116030757-116030779 AGGGGGAAAAGGAAGGAGGGAGG - Intergenic
936865006 2:117067277-117067299 AGTGAGAAGAGGAAGGAGTGGGG + Intergenic
937307328 2:120880452-120880474 CGGGGAAGGAGGAAGGAGGATGG - Intronic
937509859 2:122583148-122583170 AGAAGAAAAAGGAAGGAGGAAGG + Intergenic
937897664 2:126990859-126990881 AGTGACAAGAGGAAGGAAAAGGG + Intergenic
938670384 2:133580976-133580998 AAGGGAAAGAGGAAGGAGGTTGG - Intergenic
938685996 2:133738252-133738274 AGAGGAAAGAGGAATGGGGATGG + Intergenic
938813851 2:134879389-134879411 ATTAGTAGGAGGAAGTAGGAAGG - Intronic
940759795 2:157725259-157725281 AGGGGTAAGAGGAGGGGGAATGG + Intergenic
940900988 2:159126026-159126048 AGTGAGAAAAGGCAGGAGGAAGG - Intronic
941038211 2:160590557-160590579 AGGGGGAAGAGGAAGGGGGAGGG - Intergenic
941060117 2:160837425-160837447 GGGGGTCAGAGGAAGGAGGATGG - Intergenic
941420646 2:165279734-165279756 AGAGATTAGTGGAAGGAGGAGGG + Intronic
941705064 2:168649738-168649760 GGAGGGAAGAGAAAGGAGGATGG - Intronic
942103309 2:172607639-172607661 AATGGTACTAGGAAGGAGGTTGG + Intronic
942544959 2:177054132-177054154 AGTGGTGAGAGGAAGGAGAATGG + Intergenic
942666981 2:178330088-178330110 AGTGATTGTAGGAAGGAGGATGG - Intronic
943556904 2:189416561-189416583 TGGGGTAGGAGGAAGGGGGAGGG + Intergenic
944079618 2:195772038-195772060 GATGGTAACAGGCAGGAGGATGG + Intronic
944131203 2:196349228-196349250 AGAGGAAATAGGAATGAGGATGG - Intronic
944198372 2:197079487-197079509 AATGCTTAGAGGAAGGAGCACGG + Intronic
944222656 2:197317740-197317762 AGTGGGAACAGGGAGGACGATGG + Intergenic
944970019 2:204981869-204981891 ATTGGTTAGAGGAGAGAGGAAGG + Intronic
945068339 2:205966118-205966140 AGTGTTAAGAGAAAGGAAGATGG + Intergenic
945538702 2:211055143-211055165 GTTGGTGAGAGGGAGGAGGAGGG + Intergenic
946199898 2:218065341-218065363 AGAGGGGCGAGGAAGGAGGAAGG + Intronic
946287373 2:218714222-218714244 AGAGCAAAGAGGAAGGAAGAAGG + Intronic
946346934 2:219118466-219118488 AGTGGGAAGATGGAGGGGGAGGG + Intronic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
946393428 2:219430293-219430315 TGTGGTGAGAGGAAGGAGGGAGG - Intergenic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946888980 2:224254676-224254698 AGTGCTGAGAGGAAGGAGTGGGG - Intergenic
947206563 2:227666633-227666655 AGTGGAAAGAGGAAAGAAAATGG + Intergenic
947425686 2:229981006-229981028 TGTCTTCAGAGGAAGGAGGAGGG + Intronic
947760949 2:232603425-232603447 GGTGGAAGGAGGAAGGAGGAAGG + Intergenic
948091875 2:235302016-235302038 AGTATGAAGAGGGAGGAGGAGGG - Intergenic
948091948 2:235302218-235302240 AGAGGGAGGAGGAGGGAGGAGGG - Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
948316553 2:237031808-237031830 TGGGGAAAGAGGAAGGAGGGAGG + Intergenic
948458612 2:238118650-238118672 AGTGGTTGGAGGAGGGTGGATGG + Intronic
948577647 2:238964986-238965008 GGAGGAAAGAGGAAGGAGGAAGG - Intergenic
948577688 2:238965110-238965132 AGAGGAGGGAGGAAGGAGGATGG - Intergenic
948577695 2:238965135-238965157 AGAGGGAAGAGGGAGGAGGGAGG - Intergenic
948577715 2:238965205-238965227 GGAGGAAAGAGGAAGGAGGGAGG - Intergenic
948577738 2:238965285-238965307 AGAGGGAAGAGGGAGGAGGGAGG - Intergenic
948577754 2:238965345-238965367 GGAGGAAAGAGGAAGGAGGGAGG - Intergenic
948702363 2:239768414-239768436 AGTGGGAAGAGGTGGGAGGTAGG - Intronic
948756950 2:240165539-240165561 CCTGGGAAGTGGAAGGAGGATGG + Intergenic
948883830 2:240873333-240873355 AGTGGGAAGAGGAAGGGCCAGGG + Intronic
948925117 2:241091295-241091317 AGTCGTTACCGGAAGGAGGAGGG + Intronic
1169118830 20:3083539-3083561 AGGGCGAGGAGGAAGGAGGAAGG - Intronic
1169431825 20:5543058-5543080 TTTGGTAGAAGGAAGGAGGAAGG + Intergenic
1169476940 20:5940155-5940177 AGCGGGTAGAGAAAGGAGGATGG - Intronic
1169550833 20:6699595-6699617 AGGGGAGAGAGGAAGGAAGATGG - Intergenic
1169924939 20:10773332-10773354 TGAGGAAAGAGGGAGGAGGAAGG - Intergenic
1169929480 20:10816887-10816909 AGGGGTGGGAGGGAGGAGGAAGG + Intergenic
1169975956 20:11328235-11328257 GGTGGAAAGATGAAGGAGGGAGG + Intergenic
1170032272 20:11955891-11955913 AGTGGGAAGAGAAAAGAGGATGG + Intergenic
1170053604 20:12174501-12174523 AGTTCTAAGAGGAAGCAGGAGGG - Intergenic
1170427283 20:16247438-16247460 ATTGGGCAGAGGAAGGAGTAGGG + Intergenic
1170624629 20:18021805-18021827 AGGGGAAAGAGGAAGCAGGGAGG + Intronic
1170836938 20:19892671-19892693 AGAAGGAAGAGGAAGGAGGCTGG - Intronic
1170929198 20:20753633-20753655 ACTGGTAAGAGAAAGGGGTAAGG - Intergenic
1170978719 20:21190954-21190976 AATTGTAAGATGGAGGAGGAGGG + Intronic
1171203463 20:23260354-23260376 AGTGGTAAGATCCATGAGGAAGG + Intergenic
1171292466 20:23990163-23990185 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
1171293343 20:23995006-23995028 AGTCGTATGGGGAAGGAGGTTGG + Intergenic
1171824238 20:29879327-29879349 ACTGGATAGAGGAGGGAGGAGGG + Intergenic
1171894330 20:30745723-30745745 AGTAATAATAGGAAGGAGGGTGG + Intergenic
1172174499 20:32963965-32963987 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1172411304 20:34725467-34725489 TGTGATCAGAGGAATGAGGACGG + Intronic
1172459015 20:35101209-35101231 GCTGGCAAGGGGAAGGAGGAAGG - Intergenic
1172479924 20:35265096-35265118 TGGGGTGAGAGGAAGGAGGGAGG + Intronic
1172535344 20:35668645-35668667 AGTGGTAAGAGGACATAGCAGGG - Exonic
1173007593 20:39152023-39152045 AGTGGTGAGAGGAAAGGAGAAGG + Intergenic
1173053023 20:39583674-39583696 AGAGGAAAGGGGAAGGGGGAAGG + Intergenic
1173571394 20:44078976-44078998 AGGAGTAAGAGGAAGCTGGAAGG - Intergenic
1173698403 20:45043844-45043866 AGGGGAAAGTGGAAGGAGGGAGG - Intronic
1173747393 20:45448374-45448396 TGTGGGGAGAGGAAGGAGGCAGG - Intergenic
1174006620 20:47416039-47416061 GGAGGAAGGAGGAAGGAGGAAGG + Intergenic
1174006622 20:47416046-47416068 GGAGGAAGGAGGAAGGAGGAAGG + Intergenic
1174006624 20:47416053-47416075 GGAGGAAGGAGGAAGGAGGAAGG + Intergenic
1174461829 20:50688784-50688806 AGAGGAAAGAGGAAGCAGGAAGG + Intronic
1174960500 20:55151682-55151704 AGTAGGAGGAGGAAGAAGGAAGG - Intergenic
1175120112 20:56710676-56710698 AGTGGGAAGAGGAAGAGGGGAGG - Intergenic
1175142742 20:56872925-56872947 GGAGGGAAGAGGAAGAAGGAAGG + Intergenic
1175230431 20:57470390-57470412 ACTGGTAGGAGGAAGGCCGAGGG - Intergenic
1175657774 20:60786927-60786949 AAGGGGAGGAGGAAGGAGGAGGG - Intergenic
1175786499 20:61715431-61715453 CATGGTATGAGGAAGCAGGAGGG - Intronic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1176607518 21:8845858-8845880 AGTAATAAAAGGAAGGAGGGTGG - Intergenic
1176672227 21:9745253-9745275 AGGGGCAAGAGGAAGGAGACAGG + Intergenic
1177116049 21:17088205-17088227 GGAGGGAGGAGGAAGGAGGAAGG + Intergenic
1177146903 21:17416603-17416625 ACTGGGAAGGGAAAGGAGGAAGG + Intergenic
1178308997 21:31514112-31514134 GGTGGGATGAGGCAGGAGGATGG - Intronic
1178546084 21:33494013-33494035 ACTGGTATTGGGAAGGAGGATGG - Intergenic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1179048329 21:37866798-37866820 GTTGGAAAGAGAAAGGAGGATGG + Intronic
1179049335 21:37875382-37875404 AGGGGGAGGAGGAAGCAGGATGG - Intronic
1179084855 21:38207602-38207624 AGTGGGGAGGGGAGGGAGGAAGG - Intronic
1179150649 21:38805875-38805897 AGCGGGAGGAGGAGGGAGGAGGG - Intronic
1179787810 21:43739880-43739902 TGGGGTAAGGGGTAGGAGGAGGG - Intronic
1180124922 21:45784456-45784478 AGAGGTAGGAGGTAGGAGGTAGG - Intronic
1180357605 22:11855650-11855672 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1180380659 22:12136683-12136705 AGTAATAATAGGAAGGAGGGTGG + Intergenic
1180581489 22:16843360-16843382 AGGAGTAGGAGGAAGAAGGAAGG + Intergenic
1180824404 22:18852721-18852743 AGTCGTATGGGGAAGGAGGTTGG + Intronic
1181043506 22:20203973-20203995 AGTGGGGAGGGGAAGGAGAAGGG + Intergenic
1181123961 22:20691023-20691045 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
1181124829 22:20695875-20695897 AGTCGTATGGGGAAGGAGGTTGG + Intergenic
1181188330 22:21121827-21121849 AGTCGTATGGGGAAGGAGGTTGG - Intergenic
1181210868 22:21288666-21288688 AGTCGTATGGGGAAGGAGGTTGG + Intergenic
1181328354 22:22069061-22069083 AGTGAGAACAGGTAGGAGGATGG - Intergenic
1181501373 22:23317578-23317600 AGTCGTATGGGGAAGGAGGTTGG - Exonic
1181650780 22:24257837-24257859 AGTCGTATGGGGAAGGAGGTTGG + Intergenic
1181706602 22:24652902-24652924 AGTCGTATGGGGAAGGAGGTTGG - Intergenic
1181885311 22:26017379-26017401 AGGGAGAGGAGGAAGGAGGAGGG - Intronic
1181907317 22:26209698-26209720 AAAAGAAAGAGGAAGGAGGAAGG + Intronic
1181931337 22:26403943-26403965 AGGAGGAGGAGGAAGGAGGAAGG + Intergenic
1181931339 22:26403950-26403972 GGAGGAAGGAGGAAGGAGGAAGG + Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182090416 22:27590938-27590960 AGAGGGAAGAGGAGGGAGGGAGG + Intergenic
1182268536 22:29138019-29138041 GATGTTTAGAGGAAGGAGGACGG - Intronic
1182272093 22:29160730-29160752 AGTGTTAAGAGGAAAGCTGATGG + Intronic
1182329836 22:29543380-29543402 ATGGGGAGGAGGAAGGAGGAAGG + Intronic
1182931468 22:34178288-34178310 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1183064799 22:35355380-35355402 AGTGCTAAGGGGAGGGAGGAGGG + Intergenic
1183428453 22:37751825-37751847 AGAGGTAAGAGGACTGAGGCCGG + Exonic
1183445042 22:37848037-37848059 AGTGGGAAAAGCAAGGAGGGCGG + Intronic
1183613053 22:38923682-38923704 AGGGAGGAGAGGAAGGAGGAAGG - Intergenic
1184024964 22:41848687-41848709 AGGGCTTAGAGGAAGGAGTAAGG + Intronic
1184109910 22:42388616-42388638 GGTGCTCAGAGGCAGGAGGAGGG + Intronic
1184387863 22:44186521-44186543 TGAGGGAATAGGAAGGAGGATGG - Intronic
1185072874 22:48666908-48666930 AGTGGTTGGAGGGAGGAGGAGGG + Intronic
1185089395 22:48757297-48757319 AGGAGGAAGAGGAAAGAGGAGGG + Intronic
1185229812 22:49673560-49673582 AGGGGGAAGGGGAAGGGGGAGGG + Intergenic
1185243955 22:49763410-49763432 TGGGGGAAGAGGAAGGAGGAGGG + Intergenic
1203216079 22_KI270731v1_random:6764-6786 AGTCGTATGGGGAAGGAGGTTGG - Intergenic
1203273675 22_KI270734v1_random:73830-73852 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
1203274542 22_KI270734v1_random:78625-78647 AGTCGTATGGGGAAGGAGGTTGG + Intergenic
949108639 3:231292-231314 AGAGAGGAGAGGAAGGAGGAAGG - Intronic
949460806 3:4291442-4291464 AGTGGTAAAAAGAAGGAGAGAGG - Intronic
949461303 3:4297639-4297661 TGAGGTAGGAGGATGGAGGATGG - Intronic
949642875 3:6059315-6059337 AGAGGTAGGAGTAAGGAGGCTGG - Intergenic
949914177 3:8944594-8944616 AGGGGAAGGAGAAAGGAGGAGGG + Intronic
950130052 3:10536459-10536481 AGGAGGAGGAGGAAGGAGGAAGG - Intronic
950158577 3:10742401-10742423 AGCGGTGAGAGAAAGGATGAAGG - Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950192552 3:10987667-10987689 AGTGGTAAGAAGCTGAAGGAAGG + Intergenic
950545793 3:13637234-13637256 AGAGGGAAAAGGAAGGAGAAAGG + Intronic
950546036 3:13638625-13638647 GGAGGGAGGAGGAAGGAGGAGGG - Intergenic
950741586 3:15056543-15056565 TGTGGTCAGAGGGAGGTGGAAGG + Intronic
950954347 3:17035558-17035580 AGTGGGAACAGGAAGCAGGTGGG - Intronic
951194143 3:19804718-19804740 AGGGGGAGGAGGGAGGAGGAGGG + Intergenic
951220275 3:20061138-20061160 AGGGGTTGGAGGAAGGAAGAGGG - Intronic
951708672 3:25568527-25568549 AGTGGTGAAAGGAAAGAGCAAGG - Intronic
951870096 3:27352072-27352094 ATTGGGAAGAGTAAGGGGGAAGG + Intronic
952259288 3:31724144-31724166 AGAGAAAAGGGGAAGGAGGAGGG + Intronic
952541557 3:34372863-34372885 TGTGGGAAGAAGAAGGAAGATGG + Intergenic
953190174 3:40678585-40678607 ATTGGGAAAAGGAAGCAGGATGG - Intergenic
953230263 3:41058369-41058391 AGGAGGAAGAGGAAGGAGGGAGG + Intergenic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953492446 3:43363159-43363181 AGTAGCAACAGGAAGAAGGAAGG - Intronic
953703706 3:45215624-45215646 AGCTGTAAGAGGAATGTGGATGG - Intergenic
953854651 3:46491955-46491977 AGGGGTGGGAGGAGGGAGGACGG - Intergenic
954268402 3:49488238-49488260 AGATGGAAGAGGAAGGAGGTGGG - Intronic
954268636 3:49490033-49490055 AGTGGTAAGAGAAAGGAACACGG - Intronic
954411764 3:50374121-50374143 GGAGGTAAGGGGAAGGAGGAAGG + Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955446392 3:59015544-59015566 GAAGGAAAGAGGAAGGAGGAGGG + Intronic
955939470 3:64133988-64134010 AGAGTTAAGAGGAAGGTGGCAGG + Intronic
956161026 3:66352773-66352795 AGAGGTATGGGGAAGGGGGATGG - Intronic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956325655 3:68049775-68049797 GGTGGTGAGGGGAAGGAGCAGGG + Intronic
956329761 3:68093298-68093320 ACAGGAAAGAGGAAGTAGGAAGG - Intronic
956664640 3:71631044-71631066 AATGGGAAGAGGGATGAGGAAGG - Intergenic
956989372 3:74745454-74745476 ATAGGAAAGAGGAAGGAAGAAGG - Intergenic
957274315 3:78070817-78070839 AGTAGTAGGAAGAAGGATGACGG + Intergenic
957652920 3:83032538-83032560 AGAGGGAAGAGGAGGGAGAAGGG - Intergenic
957856816 3:85890161-85890183 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
958682301 3:97346579-97346601 ATTAGTAAGGGAAAGGAGGAAGG + Intronic
958687155 3:97413380-97413402 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
958886069 3:99728383-99728405 CATGGTAGGAGGAAGCAGGAAGG - Intronic
959133900 3:102392551-102392573 GGAGGAAGGAGGAAGGAGGAAGG - Intronic
959133902 3:102392558-102392580 GGGGGAAGGAGGAAGGAGGAAGG - Intronic
959962501 3:112314777-112314799 AGAGGAAAGAGGAAGCAGAAGGG + Intergenic
960197510 3:114787568-114787590 AGTGGTGAGAGGATGGATAAAGG + Intronic
960684408 3:120282713-120282735 AGAGGGAAGAGCAAGGACGATGG + Intronic
960831011 3:121847919-121847941 AGGGAGAAGAGGAAGGATGAAGG + Intronic
961214957 3:125152314-125152336 CGTGGTATGAGGAATGAGCATGG - Intronic
961345308 3:126260187-126260209 AGGGGGAAGAGAAGGGAGGAAGG - Intergenic
961381737 3:126500038-126500060 GCAGGTAGGAGGAAGGAGGAGGG - Exonic
961543506 3:127616811-127616833 AGTGGGAAGTGAGAGGAGGAGGG - Intronic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
962778049 3:138682543-138682565 AGTGGTAAAAGCAAGCAAGAAGG - Intronic
962967565 3:140368624-140368646 AGTCCTAGGAGGAAGCAGGAAGG - Intronic
963390914 3:144663130-144663152 ATTTGTAAGAGGAGGGAGGCAGG - Intergenic
963638748 3:147832992-147833014 AGTGATAAGAGAAAGCAGGAGGG - Intergenic
963868876 3:150392209-150392231 AATGGAAAGAGAAAGAAGGAAGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964248853 3:154686568-154686590 AATGGGAACAGGAAGGATGAAGG - Intergenic
964763156 3:160153377-160153399 AGGGGCAAGAGGAGGGAGGAAGG - Intergenic
965079537 3:164019668-164019690 AGTGGTAGTGAGAAGGAGGAGGG + Intergenic
965390413 3:168096155-168096177 GGTGGGAAGAGGCAGGCGGAAGG + Intergenic
965608290 3:170518526-170518548 AGTGGAAAGAGAATGGAGGCAGG - Intronic
966331493 3:178819533-178819555 AGCGGGCAGAGGAAGCAGGAGGG - Intronic
966470900 3:180287840-180287862 AGAGAAGAGAGGAAGGAGGAAGG - Intergenic
966521911 3:180882409-180882431 GGAGGAAGGAGGAAGGAGGAAGG - Intronic
966521913 3:180882416-180882438 AGGAGAAGGAGGAAGGAGGAAGG - Intronic
966656201 3:182361243-182361265 AGTGAAAAGATGAAGGAAGAGGG - Intergenic
967070672 3:185959886-185959908 AGTGGTAACAGGAACAAGGAGGG + Intergenic
967264229 3:187676050-187676072 AGTGGTTAGAGGGATTAGGAGGG - Intergenic
967640175 3:191853177-191853199 GGTGGTATGAGGAAGCAGGAAGG + Intergenic
967877278 3:194275890-194275912 AGTGGGGAGCGGAAAGAGGAGGG - Intergenic
967888846 3:194351048-194351070 GCTGGGAAGAGGCAGGAGGAAGG - Intronic
967956798 3:194883565-194883587 AGTGGCTAGAGGAAGGGTGAGGG + Intergenic
968076280 3:195817431-195817453 CCTGGTAAGAAGAAGGAGGCTGG - Intergenic
968123361 3:196141662-196141684 AGGGGAAAGAGGAAAGAAGAAGG + Intergenic
968276408 3:197443780-197443802 AGTGCTGGGTGGAAGGAGGAGGG + Intergenic
968481096 4:833439-833461 AGAGGAAGGAGGAAGGTGGAAGG + Intergenic
968481139 4:833556-833578 GGTGGAAGGAGGAAGGAAGAGGG + Intergenic
968626694 4:1629131-1629153 GCTGGGAAGAGGAAGGAGCAGGG + Intronic
968889283 4:3359165-3359187 AGGGGGAGGAGGGAGGAGGAGGG - Intronic
968952019 4:3700249-3700271 AGTGGGGAGGGTAAGGAGGAGGG + Intergenic
969239799 4:5890677-5890699 AGGGAGAAGAGGAAGGAGTAGGG + Intronic
969551274 4:7869224-7869246 AGGAGGAAGGGGAAGGAGGAAGG + Intronic
969853119 4:9977611-9977633 AGAGGTAAGAGTATGGGGGAAGG - Intronic
969901430 4:10354143-10354165 AGTGGAAGGAGGAAGCAGGAAGG + Intergenic
969973774 4:11076506-11076528 AGTGGTGAGAGGCAGGAGCCTGG + Intergenic
970943759 4:21665862-21665884 TATGGTCAGAGGAAGGATGAAGG - Intronic
971172801 4:24250615-24250637 AGAAGGAAGAGGAAGGAGAAGGG + Intergenic
971178673 4:24306794-24306816 AGTAGTAATAGGAAGGAGGAAGG + Intergenic
971460381 4:26889720-26889742 AGAGGCCATAGGAAGGAGGAAGG - Intronic
971466404 4:26967799-26967821 AGGGGGAAGAGGAAAGTGGAGGG - Intronic
972169213 4:36324277-36324299 AGTTGAAGGAGGAAGGAGGAGGG - Intronic
972252947 4:37324038-37324060 AGTGGCGAGAGGAAGGGAGAGGG + Intronic
973335794 4:48955350-48955372 GGAGGAAAGAGGAAGGAGGAAGG - Intergenic
973849294 4:54945497-54945519 AGAGGGGAGAGGAAGAAGGAAGG + Intergenic
973885613 4:55318027-55318049 AGGAGGAAGAGGAAGGAGAAGGG + Intergenic
974030771 4:56774303-56774325 AGTTATAAGTGGAAGGAAGAAGG - Intergenic
974199301 4:58618487-58618509 AGTGGTAAGTAGAAGAGGGATGG + Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975452360 4:74544133-74544155 AGTGGTAGGAGGATGGAGGGTGG + Intergenic
975752726 4:77540410-77540432 AGAGGAAGGAGGAAGGAGGCAGG - Intronic
976851909 4:89557447-89557469 AGTGGTCAGATGAAGGAAAAAGG + Intergenic
978145800 4:105369788-105369810 AGGGATAAGAGGAGGGAGAAGGG + Intronic
978652785 4:111027296-111027318 AGTGACAACAGGAAGAAGGAGGG - Intergenic
979205054 4:118029381-118029403 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
979230621 4:118345324-118345346 ATTTGTAAGAAGGAGGAGGAGGG + Intronic
979552766 4:122009700-122009722 AGGACTAAGAGGCAGGAGGAGGG + Intergenic
979558945 4:122080470-122080492 AGGGGAAAGAAGAAAGAGGAGGG + Intergenic
979798002 4:124871266-124871288 ACTGGGAAAAGGTAGGAGGAAGG - Intergenic
979960513 4:127015311-127015333 ATTGGGATGAGGAATGAGGAAGG - Intergenic
979981331 4:127258885-127258907 AGTTCAAAGAGGAAGCAGGAGGG - Intergenic
980417914 4:132517340-132517362 AGTGCTGAGAGGAAGAAAGATGG + Intergenic
980540651 4:134189641-134189663 AGTGGTAAGATGTGGGTGGAAGG + Intergenic
980654803 4:135767512-135767534 AGGGGTAAGGGGAAAGAGGAGGG + Intergenic
981091639 4:140738467-140738489 AGGGGAAAGAGCAAGAAGGAGGG - Intronic
981538496 4:145824638-145824660 ACTGGTGAGAGGTAGGGGGAGGG - Intronic
981616885 4:146651806-146651828 AGGGGAAAATGGAAGGAGGAAGG - Intergenic
981637963 4:146902152-146902174 AGGGAAAAGAGGAAGGGGGATGG - Intronic
982204553 4:152988181-152988203 AGGGGTCAGAGGAAAGATGATGG - Intergenic
982346188 4:154362735-154362757 AGGAGGAAGAGGAAGGAGAAGGG - Intronic
983328806 4:166296739-166296761 ATTAGTAAAAGGAAAGAGGATGG - Intergenic
983932293 4:173465768-173465790 AGGGGGAAGCGGAGGGAGGAAGG - Intergenic
984150538 4:176124450-176124472 AATGGTAAGACGAATGAGAAAGG + Intronic
984290399 4:177787206-177787228 AGTTCTAAGTGGAAGGAGTAGGG + Intronic
984505067 4:180607168-180607190 AGTGGTAAGAAAAAGGAAGCAGG + Intergenic
984703553 4:182833357-182833379 AGGGGAGAGGGGAAGGAGGAGGG - Intergenic
984703982 4:182834573-182834595 AGGGGAAAGGAGAAGGAGGAGGG - Intergenic
984747130 4:183232432-183232454 AGGGCTCAGAGGATGGAGGAGGG - Intronic
984843166 4:184087079-184087101 AGTGGTAGGAGGCAGGGGGAGGG - Intergenic
985117364 4:186605302-186605324 AGTGAGAAGGGGGAGGAGGAGGG + Intronic
985167920 4:187117212-187117234 AGTGGGATTAGGCAGGAGGAAGG + Intergenic
985679139 5:1246847-1246869 GGAGGAAAGAGGGAGGAGGAGGG - Intergenic
986427629 5:7650562-7650584 AGTGGGCTCAGGAAGGAGGAAGG - Intronic
986592865 5:9389553-9389575 TTTGGTAAGATGGAGGAGGAGGG - Intronic
986920770 5:12676635-12676657 ACTGATAACAGGAAGGGGGAAGG + Intergenic
987189224 5:15456948-15456970 AGTGGTTAGGGGGAGGGGGAGGG - Intergenic
987708155 5:21481497-21481519 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
987708332 5:21482313-21482335 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
987708508 5:21483120-21483142 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
987816682 5:22910780-22910802 ACTGGCTAGAGGAAGGAGGCTGG - Intergenic
988247543 5:28706859-28706881 AGGGGAAAGAGTAAGCAGGAGGG + Intergenic
988451397 5:31347130-31347152 AGTTGTATGAGGAAGGAAAAGGG + Intergenic
988751103 5:34191025-34191047 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
988751281 5:34191835-34191857 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
988751449 5:34192642-34192664 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
988776434 5:34481787-34481809 AGGGGAAAGAGCAAGTAGGAAGG - Intergenic
989110924 5:37905974-37905996 AGTGGGAAAATGAAGTAGGAAGG - Intergenic
989341256 5:40378202-40378224 AATGGCAATAGGAAGGAAGAAGG + Intergenic
989415440 5:41169682-41169704 AGTGGTAGGAGGAGGGTGAAGGG + Intronic
989775784 5:45205715-45205737 AGTAGTAAGAGAGAGGGGGAAGG - Intergenic
989973359 5:50551839-50551861 GGTGGAAGAAGGAAGGAGGAGGG + Intergenic
989994195 5:50808248-50808270 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
990309401 5:54523758-54523780 AGTGGTAAAAGGAAGCACAATGG - Intronic
990991239 5:61686067-61686089 AGAGGTGAGAAGAAGGAAGAGGG - Intronic
991132351 5:63137156-63137178 AGTGGTTGGAGACAGGAGGAAGG + Intergenic
991217607 5:64173615-64173637 AGGGGAAAGGGAAAGGAGGAGGG - Intronic
991436048 5:66597439-66597461 GGGGGTAAGAGGCAGGAGTAGGG + Intronic
991563693 5:67982525-67982547 TGTGGTAAGGGGAGGGAGGAGGG + Intergenic
991736417 5:69633756-69633778 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991736592 5:69634569-69634591 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991736767 5:69635385-69635407 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991736940 5:69636204-69636226 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991739375 5:69654237-69654259 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991758125 5:69898942-69898964 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
991758299 5:69899758-69899780 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
991758473 5:69900574-69900596 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
991758643 5:69901387-69901409 AGTGGTAAGAGGTGGCAGGAAGG + Intergenic
991788513 5:70215928-70215950 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991790950 5:70233978-70234000 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991812915 5:70489395-70489417 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991813093 5:70490214-70490236 AGTGGTAAGAGGTGGCAGGAAGG - Intergenic
991813265 5:70491033-70491055 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991815873 5:70509872-70509894 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991816046 5:70510685-70510707 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991816221 5:70511495-70511517 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991816397 5:70512314-70512336 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991818837 5:70530354-70530376 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991837528 5:70774824-70774846 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
991837702 5:70775640-70775662 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
991837872 5:70776453-70776475 AGTGGTAAGAGGTGGCAGGAAGG + Intergenic
991880961 5:71216292-71216314 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
991883398 5:71234313-71234335 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
992203925 5:74411464-74411486 AGAGGTAAAAGGCAGGTGGAGGG - Intergenic
992229047 5:74645304-74645326 AGGAGGAAGAGGCAGGAGGATGG - Intronic
992263164 5:74990751-74990773 AGAGGTAAGAGGCAGGGGGAGGG + Intergenic
992410562 5:76501556-76501578 AGTGGTATGGGGTGGGAGGAAGG - Intronic
992599312 5:78381944-78381966 AGAGGAAAGAGGTTGGAGGAAGG + Intronic
992799150 5:80280313-80280335 AGAGGGAAGTGTAAGGAGGAGGG - Intergenic
993204634 5:84863465-84863487 AGAGGGAAGGGGAGGGAGGAAGG - Intergenic
993340376 5:86718249-86718271 ATGGGGAAGAGGGAGGAGGAAGG - Intergenic
993475364 5:88357754-88357776 AGGGGGTACAGGAAGGAGGATGG + Intergenic
994048426 5:95335197-95335219 GGAGGGAGGAGGAAGGAGGAAGG - Intergenic
994058300 5:95445416-95445438 ACTGGGAAGAGGTAGGATGAGGG - Intronic
994420402 5:99523327-99523349 AGTGGGAAGAGGTGGCAGGAAGG + Intergenic
994486973 5:100392625-100392647 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
994760550 5:103847149-103847171 AGAGGTAAAAGGAAGGGAGAAGG + Intergenic
994833270 5:104813577-104813599 AGTTGGAAGAGGAAGGTGGGAGG - Intergenic
994869699 5:105331666-105331688 AGGGGGAGGAGGAAGGAGGGAGG + Intergenic
994945058 5:106377164-106377186 AGTGAGAAAGGGAAGGAGGAAGG - Intergenic
995177142 5:109192010-109192032 ATCGGTATGAGGCAGGAGGATGG - Exonic
995812896 5:116127776-116127798 TGTGGTGGGGGGAAGGAGGAGGG + Intronic
996192387 5:120561815-120561837 AGTGGCAAGAGAAAGAATGAGGG - Intronic
996491142 5:124098929-124098951 AGAGGTAAGCTGAAGGAAGAAGG + Intergenic
996812760 5:127537419-127537441 AGTGGTCAGAGGAAAAAGAAAGG + Intronic
997016694 5:129944230-129944252 ACTGGTAGGTGGAAGAAGGAGGG + Intronic
997191978 5:131945870-131945892 AGTGCTCAGACGGAGGAGGAGGG - Intronic
997192136 5:131946867-131946889 AGTGCTCAGATCAAGGAGGAGGG + Intronic
997209275 5:132068016-132068038 AGTGGAAAGACTGAGGAGGATGG + Intergenic
997394041 5:133542812-133542834 AGAGGAGAGAGGGAGGAGGAGGG - Intronic
997629340 5:135354881-135354903 AGTGTGAAGAGGCAGGAGGTTGG + Intronic
997747409 5:136311217-136311239 AGTGGGGTCAGGAAGGAGGAGGG + Intronic
997952083 5:138250293-138250315 AGGGGAAGAAGGAAGGAGGAAGG + Intergenic
998438236 5:142132550-142132572 AGTGGTAATAGGAGAGATGAAGG - Intronic
998570524 5:143252895-143252917 ATTGGAAAGAGCAAGAAGGAGGG - Intergenic
998698498 5:144668792-144668814 AGTGGAAACTGGTAGGAGGATGG + Intergenic
999229416 5:150052839-150052861 AGTGGCCAGGGAAAGGAGGAAGG - Intronic
999968364 5:156833877-156833899 AGGGCTAGGAGAAAGGAGGAAGG + Intergenic
1000192575 5:158925545-158925567 GGTGGCCAGTGGAAGGAGGAAGG - Intronic
1000213581 5:159133175-159133197 AATGGTAAAAGCAACGAGGAAGG - Intergenic
1000225621 5:159258595-159258617 AGTGGTCCGAGGAATGTGGATGG + Intergenic
1000308536 5:160018752-160018774 AGGGGTATGAGGATGGAGGAGGG + Intronic
1000791188 5:165609529-165609551 AGGGGTGCGAGGAGGGAGGAAGG - Intergenic
1001186424 5:169578197-169578219 AGTGGCAACAGGCAGGAGGTGGG + Intergenic
1001514358 5:172345052-172345074 AAAGGAAGGAGGAAGGAGGAAGG + Intronic
1001588155 5:172847209-172847231 GGTGGGGAGAGAAAGGAGGATGG + Intronic
1001941244 5:175741180-175741202 AGTGACAAGAGGAGGTAGGATGG - Intergenic
1001989456 5:176104379-176104401 AGTGGCAAGAGGAAATAGAAAGG - Intronic
1002227417 5:177733759-177733781 AGTGGCAAGAGGAAATAGAAAGG + Intronic
1002842351 6:917131-917153 AGAAGTGGGAGGAAGGAGGAGGG - Intergenic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1002969138 6:1996155-1996177 ATGAGAAAGAGGAAGGAGGAAGG - Intronic
1003108027 6:3229913-3229935 ATTGGTTAGATGAAGGAGGCAGG - Intronic
1003508421 6:6759168-6759190 AGAGGTGAGAGGAAAGGGGAGGG + Intergenic
1003509184 6:6765190-6765212 AGTGGTAAGAGTGAGAAGAATGG + Intergenic
1003551309 6:7104501-7104523 GGTGGAAAGAGGAGGGAGGAGGG + Intergenic
1003573492 6:7271289-7271311 ACTGTTAAGAGGCAGGAGGATGG + Intronic
1004054424 6:12121269-12121291 AGTGGGGAGAGCGAGGAGGAAGG + Exonic
1004131177 6:12921538-12921560 AGGGAAAGGAGGAAGGAGGAAGG + Intronic
1004184546 6:13410806-13410828 AGGAGAAAGAGGAAGAAGGAGGG + Intronic
1004266452 6:14152081-14152103 AGAAGGAAGAGGAAGAAGGAAGG - Intergenic
1004511555 6:16287981-16288003 AGTAATAGGATGAAGGAGGAGGG - Intronic
1004847490 6:19661588-19661610 ATGGGTTAGAGGAAAGAGGAAGG + Intergenic
1004847492 6:19661595-19661617 AGAGGAAAGAGGAAGGAGGCTGG + Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005149088 6:22727725-22727747 GGTGGTAAGAGAAGGGAGAAGGG - Intergenic
1005255374 6:23997257-23997279 AGGGGGAAGGGGAAGCAGGAGGG - Intergenic
1005271205 6:24165481-24165503 AGAGGAAAGAGCAAGCAGGAGGG - Intergenic
1005273301 6:24189329-24189351 AGTGGTAAGGGGAAAGAAGATGG + Intronic
1005386845 6:25293722-25293744 AAAGGGAAGAGGAAGGGGGAAGG - Intronic
1005549253 6:26897654-26897676 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
1005882996 6:30074650-30074672 ACTGACAAGAGGATGGAGGAAGG - Intronic
1006020652 6:31115830-31115852 TTTGAGAAGAGGAAGGAGGAAGG + Exonic
1006208023 6:32366933-32366955 AGAGGTAAGAAGGAGAAGGATGG + Intronic
1006369623 6:33635832-33635854 AGGGGTGAGGGGAAGGGGGATGG + Intronic
1006409153 6:33862281-33862303 AGTGTGAAGAGGATGCAGGAAGG + Intergenic
1006473279 6:34239997-34240019 AGGGGTAAGGGGAAAGAGGAGGG + Intronic
1006881511 6:37343976-37343998 CATGGTAAGAGCAAGCAGGATGG + Intergenic
1006935422 6:37713866-37713888 GCTGGTCAGATGAAGGAGGATGG - Intergenic
1007120660 6:39377911-39377933 AGTGAGAAGAGGGAGGAGGGAGG + Intronic
1007122813 6:39397436-39397458 AGAGGAAAGAGGAAGGAGAGAGG + Intronic
1007138334 6:39544885-39544907 AGAGGGTTGAGGAAGGAGGAGGG - Intronic
1007180608 6:39926760-39926782 AGTGGGGAGAGGCAGAAGGAAGG + Intronic
1007511859 6:42380179-42380201 TGTGGTAACAGTGAGGAGGAGGG + Intronic
1007610490 6:43145822-43145844 AGTGGTGCTAGGAAGGAGGGAGG - Intronic
1007735736 6:43981248-43981270 AGGGGAGAGAGGAAGAAGGAAGG + Intergenic
1008484562 6:52021737-52021759 AGAGGGAAGAGGAAGAAGAAGGG - Intronic
1008665995 6:53717024-53717046 GGTGGTCAGAGGTAGGAGGAAGG + Intergenic
1008823124 6:55657909-55657931 AGTGGAAGGTGGAAGGAGGGGGG + Intergenic
1008863261 6:56176985-56177007 AGAGGGAGGAGGAAGGAGGAGGG + Intronic
1009019995 6:57938764-57938786 AGTGGGAAGAGGTGGCAGGAAGG - Intergenic
1009043315 6:58208354-58208376 AGAGGTACGAGGCAGAAGGAGGG - Intergenic
1009645832 6:66400017-66400039 ACTGGAAATAGGAATGAGGAGGG + Intergenic
1009797307 6:68487338-68487360 AGTGGTTAGTGGAAAGAAGATGG - Intergenic
1010042073 6:71396768-71396790 AGGGGTAGGAAGAGGGAGGAGGG - Intergenic
1010232216 6:73545106-73545128 AGGAGGAGGAGGAAGGAGGAAGG - Intergenic
1010293392 6:74166871-74166893 AGAGGAAAGAGGAAGGGAGAGGG - Intergenic
1010313230 6:74413037-74413059 AGTGGTAGGAGGAGAGAGGCAGG + Intergenic
1011227198 6:85120393-85120415 GGTGGGAAGAGGAGGGAGGTGGG - Intergenic
1011808012 6:91095288-91095310 AGTGGTAAGAAGAGTCAGGAGGG + Intergenic
1011809166 6:91110368-91110390 AGTGGTAAGAATAAGAAGCAAGG + Intergenic
1012587078 6:100936539-100936561 ATTGGGAGGTGGAAGGAGGAAGG + Intergenic
1012731937 6:102894212-102894234 AGTGGGAAGACGCAGGAGGTGGG - Intergenic
1012899762 6:104991996-104992018 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1013056598 6:106589203-106589225 AGGGGGAGGAGGGAGGAGGAGGG + Intronic
1013120552 6:107136991-107137013 GGTGGAAAGAGGAAGGGGAATGG + Intergenic
1013267157 6:108511151-108511173 GGAGGTAGGAGGAAGGAAGAAGG + Intronic
1013272810 6:108559441-108559463 AGTGGGGAGAGGAGGGAGAAGGG - Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013644878 6:112127298-112127320 ACTGGTAGGAGGTAGGAGGCAGG + Intronic
1013826138 6:114213494-114213516 AGTGATAACAGACAGGAGGAAGG - Intronic
1013837005 6:114344390-114344412 AGTGGTGGGAGGAAGGAGGTGGG - Intergenic
1014202888 6:118624401-118624423 AGCGGTAGTAGAAAGGAGGAGGG - Intronic
1014358232 6:120438557-120438579 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1014560081 6:122879449-122879471 AGTGGTGGGGGGAAGGGGGAGGG - Intergenic
1014578226 6:123100707-123100729 TGTGGAAAGAGAAAGGGGGATGG - Intergenic
1014634649 6:123830181-123830203 AGTGGTCTAAGCAAGGAGGATGG - Intronic
1014684364 6:124477702-124477724 AGGGGGAAGAGTAAGGGGGAGGG - Intronic
1014771496 6:125462948-125462970 GGTGGTAAGATGTAGGAGGAGGG + Intergenic
1015031685 6:128602999-128603021 AGTGGGAAGGGGCAGGAGGGAGG - Intergenic
1015110313 6:129585629-129585651 ACTGGTCAGAGGAAGGAGGCAGG - Intronic
1015237912 6:130992304-130992326 AGTGGTAAGGAGAAGGATGCTGG - Intronic
1015295064 6:131581727-131581749 AGTGGAAAGAGGAAGGAATGAGG - Intronic
1016307364 6:142697889-142697911 CGAGGTGAGAGGCAGGAGGAAGG - Intergenic
1016434028 6:144017325-144017347 AGTGGCAAGAGGAGGGAAGGGGG - Intronic
1016630169 6:146220619-146220641 ATGGGTAAGAGGAAGGAAAAAGG - Intronic
1016926386 6:149353281-149353303 AGAAGTAAGGGGAAGGAGTAAGG - Intronic
1017074993 6:150609754-150609776 AGTGGTACAGAGAAGGAGGATGG + Intronic
1017142533 6:151204744-151204766 AAAGGTAAGAGAAAGGAGGAGGG - Intergenic
1017258914 6:152364671-152364693 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1017548246 6:155475005-155475027 AGGGGTAAGAGGAAGTAGGTAGG + Intergenic
1017560560 6:155623889-155623911 AGGGGAAAGAGCAAGCAGGAGGG + Intergenic
1018038046 6:159898545-159898567 AGGAGGAAGAGGCAGGAGGAGGG - Intergenic
1018038077 6:159898658-159898680 AGGAGGAAGAGGAAGGAGGAGGG - Intergenic
1019025620 6:168960524-168960546 AGTGGGAAGCGGATGGAGGTTGG + Intergenic
1019320690 7:414167-414189 AGGGGGAGGAGGGAGGAGGAGGG - Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484141 7:1280823-1280845 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484170 7:1280976-1280998 AGAAGGAAGAAGAAGGAGGAAGG + Intergenic
1019494965 7:1333456-1333478 AGGGGGAGGAGGAGGGAGGAGGG - Intergenic
1019519476 7:1454266-1454288 AGTGGGGAGAGGCAGGTGGACGG + Intronic
1019535372 7:1526482-1526504 AGGAGGAAGAGGAAGAAGGAGGG + Intergenic
1019869624 7:3747768-3747790 AGTGGTAAGAGGCAGGGAGGAGG + Intronic
1020080240 7:5282853-5282875 AGAGGGAAGAGGGAGGAGGAGGG + Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020173357 7:5863206-5863228 AGGGGAAAGAGCAAGCAGGAGGG - Intergenic
1020651928 7:10886033-10886055 AGTGGTTAGATGAAGGATGATGG - Intergenic
1021130099 7:16900993-16901015 AGTTGAAAGAGGGAAGAGGATGG - Intergenic
1021547987 7:21837565-21837587 GGAGGTAAAAGGAGGGAGGATGG + Intronic
1021697136 7:23286374-23286396 AGTGGAAAGGGGAAGGAGGGAGG - Intergenic
1021736925 7:23648393-23648415 AGAGGTGGGAGGAGGGAGGATGG - Intergenic
1021789889 7:24194282-24194304 AGGAGCAAGAGGGAGGAGGAGGG + Intergenic
1021840450 7:24717850-24717872 AGTGGGAAGAGGCCGGAGGGAGG + Intronic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022037816 7:26550598-26550620 AGAAGAAGGAGGAAGGAGGAAGG + Intergenic
1022421627 7:30229000-30229022 AGAGGTAGGAGGAAGGAAGTGGG + Intergenic
1022532450 7:31075558-31075580 AGTGAGAAGAGCATGGAGGAAGG - Intronic
1023003739 7:35840179-35840201 AGGGGGAAGGGGGAGGAGGAGGG - Intronic
1023013649 7:35944515-35944537 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1023023764 7:36033493-36033515 AGAGGAAAGAGAAAGAAGGAAGG + Intergenic
1023135063 7:37043156-37043178 AGTGGTAATTGGAAGGGAGAAGG - Intronic
1023225129 7:37960995-37961017 TGTGGTAAGGTGAGGGAGGAAGG + Intronic
1023267667 7:38424836-38424858 AGATGAAAGAGGTAGGAGGAGGG + Intronic
1023805678 7:43871250-43871272 AGAGGAAAGGGGAAGGAGAAAGG + Intronic
1023837163 7:44074951-44074973 GGTGGTAAAAGGATGGAAGATGG + Intronic
1023878862 7:44307396-44307418 GGGGGTAAGCAGAAGGAGGAGGG + Intronic
1024028355 7:45433337-45433359 AGGAGGGAGAGGAAGGAGGAGGG - Intergenic
1024077481 7:45829319-45829341 AGGACAAAGAGGAAGGAGGAGGG + Intergenic
1024210998 7:47204009-47204031 AGAGGGAAGGGGAAAGAGGAAGG - Intergenic
1024240482 7:47431234-47431256 AGTTGTAAGAGGAAGGTTTATGG + Intronic
1025126929 7:56352088-56352110 AGGACAAAGAGGAAGGAGGAGGG - Intergenic
1025251089 7:57352090-57352112 AGAAGTGAGAGGAAGTAGGAGGG + Intergenic
1026191916 7:68136516-68136538 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026191924 7:68136535-68136557 AGGGGAAGGAGGAGGGAGGAGGG + Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026251690 7:68676727-68676749 GGTGGGAAGGGGAAGGAAGAAGG + Intergenic
1026998012 7:74631824-74631846 AGGGGTAACGGGAAGGAGGATGG - Intergenic
1027130136 7:75584822-75584844 AATGGAAAGTGGGAGGAGGAAGG - Intronic
1027183121 7:75953305-75953327 CGTGGAAAGAGGGAGGGGGAGGG + Intronic
1027246786 7:76373127-76373149 AATGGTCAGATGAAGGAGGGAGG + Intergenic
1027338326 7:77178281-77178303 AGTGGTAAGAGGGAGTCAGAAGG + Intronic
1027533581 7:79367140-79367162 ATGGGTAAGTGGAAGGAAGAGGG - Intronic
1027876072 7:83770389-83770411 AATGGTGAGAGGAATGAGGTAGG - Intergenic
1028094413 7:86742548-86742570 AGATGTAAGAGGAAGGATAAAGG + Intronic
1028202189 7:87974872-87974894 AGTGCTAAGAGGAAGAGGGCAGG - Intronic
1028505502 7:91566068-91566090 TGAGGAAAGTGGAAGGAGGAAGG - Intergenic
1028941539 7:96527172-96527194 AGTGAAATGAGAAAGGAGGATGG + Intronic
1028985487 7:97005715-97005737 AAAGGGAGGAGGAAGGAGGAGGG - Exonic
1029029535 7:97453345-97453367 AGAGGAAAGAGTAAGCAGGAGGG + Intergenic
1029085385 7:98007238-98007260 AGGGGAAAGAGCAAGCAGGAGGG + Intergenic
1029194348 7:98794415-98794437 GGTGGTAGGAGGATAGAGGAAGG - Intergenic
1029371068 7:100151028-100151050 GGTGGTAAGAAGGAGGAGCAAGG + Intronic
1029372920 7:100160594-100160616 AGTGGAAACAGGATGGATGAGGG + Exonic
1029777402 7:102692518-102692540 AGTGGTAAGAGGGAGTCAGAAGG - Intergenic
1030049162 7:105522656-105522678 AGCGGTAAGAAGTAGGAAGATGG - Intergenic
1030103482 7:105967095-105967117 TGGGGTGAGGGGAAGGAGGAGGG - Intronic
1030464438 7:109882135-109882157 AGTCAGAAGAGGTAGGAGGAAGG + Intergenic
1030486801 7:110179074-110179096 AGAGGGAAAAGAAAGGAGGAAGG + Intergenic
1030646772 7:112070276-112070298 AGGGGTGGGAGGAAGAAGGAAGG + Intronic
1031079412 7:117243636-117243658 AATGGAAGGAGGAAGGAGGGCGG + Intergenic
1031158952 7:118143277-118143299 AGAGGTAGGAGGAAGGCAGATGG - Intergenic
1031464407 7:122090930-122090952 AGGGGTTGGGGGAAGGAGGATGG - Intronic
1031915617 7:127560178-127560200 AGTGGAAGGTGGAAGGGGGAAGG - Intergenic
1032240093 7:130153563-130153585 ACCGGTAGGAGGAAGGAGGAAGG + Intergenic
1032342759 7:131091149-131091171 AGTGGAAAGAGAAAGCAGGAGGG - Intergenic
1032813010 7:135441976-135441998 AATGGTAAAAGGTAGGAGGAGGG + Intronic
1033090692 7:138383065-138383087 TTTGGCAAAAGGAAGGAGGAAGG - Intergenic
1033473466 7:141668941-141668963 AGTGAAAAGAGGATGGAGTATGG - Intronic
1033639495 7:143247611-143247633 AGAGAAAAGAAGAAGGAGGAAGG + Intronic
1033646510 7:143308911-143308933 AGAGGAAACAGGATGGAGGAGGG - Intergenic
1033731711 7:144187195-144187217 AGTGGGAAGAGCGAGGAGCAGGG - Exonic
1033742561 7:144285778-144285800 AGTGGGAAGAGCGAGGAGCAGGG - Intergenic
1033751342 7:144363836-144363858 AGTGGGAAGAGCGAGGAGCAGGG + Exonic
1033804365 7:144937531-144937553 AGGGGGAAGGGGAAGGGGGAAGG - Intergenic
1033806312 7:144958216-144958238 AGTTTTAAGAGAAAGCAGGAAGG - Intergenic
1034122170 7:148637918-148637940 ATTGGAAAGAGGTTGGAGGATGG - Intergenic
1034361612 7:150504443-150504465 TGTGGGATGAGGAATGAGGAAGG + Intergenic
1034431483 7:151043399-151043421 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431558 7:151043710-151043732 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431570 7:151043748-151043770 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431595 7:151043825-151043847 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034941406 7:155232663-155232685 GCTGGGAAGAGGAAGGAGGCAGG + Intergenic
1034978909 7:155463431-155463453 AGGAGCAGGAGGAAGGAGGAAGG - Exonic
1035143325 7:156786233-156786255 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1035143327 7:156786240-156786262 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1035380147 7:158432856-158432878 AGTGAAAACAGGAACGAGGAAGG + Intronic
1035482196 7:159196372-159196394 AGTGGTAAGAAGGAGCAGGCCGG - Intergenic
1035899933 8:3448376-3448398 AGGGGGAGGAGGGAGGAGGAAGG + Intronic
1036128209 8:6083190-6083212 AGTGGAAAGAGAGAAGAGGATGG + Intergenic
1036158430 8:6363962-6363984 AGTGCTGACAGGGAGGAGGATGG - Intergenic
1036203386 8:6787594-6787616 GGTGGCAAGTGGAGGGAGGAGGG - Intergenic
1036456504 8:8913528-8913550 AGTGGTAAGTGCATGGAGGGAGG - Intergenic
1036543269 8:9740116-9740138 AGTTGTAAGAGGAAGAGAGATGG + Intronic
1036587848 8:10141472-10141494 AGTGGTTAGATGAAGCAGGAGGG - Intronic
1037471179 8:19212605-19212627 AGCTGTAAGAGGAAAGAGAAAGG - Intergenic
1037644739 8:20783046-20783068 AGTGGAGAGAGGAAGCTGGAAGG + Intergenic
1037676977 8:21059417-21059439 AGTGGCAAGGAGAAGGAGAAGGG - Intergenic
1037753411 8:21696929-21696951 AGGGGACAGAGGAAGGGGGAGGG + Intronic
1037762689 8:21752416-21752438 AGTGGAAGGAGGCAGGAGGGAGG - Intronic
1037802368 8:22042754-22042776 AGAGAAAAGAGGGAGGAGGAGGG - Exonic
1038022311 8:23560889-23560911 AGGGGAAAGAGCAAGCAGGAGGG + Intronic
1038076072 8:24076609-24076631 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1038076074 8:24076616-24076638 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1038076076 8:24076623-24076645 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1038076078 8:24076630-24076652 GGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1038076080 8:24076637-24076659 AGAAGAAGGAGGAAGGAGGAAGG - Intergenic
1038076082 8:24076644-24076666 AGAAGAAAGAAGAAGGAGGAAGG - Intergenic
1038344126 8:26716485-26716507 GGTAGTAAGAGGAAGAGGGATGG + Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1039297739 8:36175279-36175301 TGTGTTAAGAGGTTGGAGGATGG + Intergenic
1039563461 8:38531515-38531537 CTTGGGAAGAGGAAGGAGGAAGG + Intergenic
1040546445 8:48401633-48401655 AGGGGTAGGAGGAAGGAGGAGGG + Intergenic
1040969147 8:53114897-53114919 AGAGGAAAGAGCAAGCAGGAGGG + Intergenic
1041767322 8:61432911-61432933 AGAGGAAAGAGCAAGTAGGAGGG + Intronic
1041774543 8:61509731-61509753 AGAGGTAGGGGAAAGGAGGAAGG - Intronic
1041860804 8:62510613-62510635 AGGAGGAAGAGGAAGGAGGAAGG + Intronic
1041870178 8:62625217-62625239 AGTGGTAAGGTGTAGGAGCAGGG + Intronic
1042155122 8:65836896-65836918 AGGGGGAGGAGGAAGGAGGATGG - Intronic
1042498094 8:69478179-69478201 AATGGTTGGAGGAAAGAGGAAGG + Intronic
1042580998 8:70279169-70279191 AGTGGTGAGAAGAGGGAGCAAGG - Intronic
1042774727 8:72418073-72418095 ATTGTTGGGAGGAAGGAGGAGGG - Intergenic
1042846039 8:73170420-73170442 TGTGATATGAGGAAGGAGGAAGG - Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1042948253 8:74176069-74176091 AGTGGCAAGAGGAAAAGGGAGGG + Intergenic
1043121672 8:76332989-76333011 AGTAACCAGAGGAAGGAGGACGG + Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044714270 8:95086561-95086583 AGAGACAAGAGGAAGGAGGGAGG - Intronic
1044912604 8:97076551-97076573 AGTGGTAAGAAGAAAAAAGATGG - Intronic
1045015058 8:97994212-97994234 AAGGGAAAGAGGAAGGAGAAGGG + Intronic
1045015069 8:97994240-97994262 AAGGGAAAGAGGGAGGAGGAGGG + Intronic
1045085405 8:98677535-98677557 AGGAGGAAGAGGAAGGAAGAAGG + Intronic
1045322015 8:101089296-101089318 ATTGGGAGAAGGAAGGAGGATGG + Intergenic
1045382622 8:101642581-101642603 GGTAGTAAGAGGAAGGCAGAGGG + Intronic
1045497725 8:102722337-102722359 AGTGGACAGTGGATGGAGGAAGG - Intergenic
1045722817 8:105133729-105133751 AGTGGGAAGGGGAAGGGGAAAGG - Intronic
1045928741 8:107599784-107599806 AATGGTCATAGGAAAGAGGAGGG + Intergenic
1046267052 8:111845034-111845056 AAAGGTAAGAGAGAGGAGGATGG - Intergenic
1046525715 8:115380002-115380024 AGAAGAAGGAGGAAGGAGGAGGG + Intergenic
1047016127 8:120725145-120725167 GGAGGTAAGTGGAAAGAGGATGG + Intronic
1047225945 8:122955617-122955639 AGTGGGAGGAGAAAGGAGAATGG - Intronic
1047312325 8:123702971-123702993 GGTGGAAAGAGGAACGAGTATGG + Intronic
1047340041 8:123972214-123972236 AGTGGAAAGAGAAATGAGGAGGG + Intronic
1047403212 8:124563048-124563070 AGTGGTAAGAGGAAGGAGGAAGG + Intronic
1047450049 8:124957055-124957077 GGTGGGAAAAGGAAGGAGAAAGG - Intergenic
1047572264 8:126111867-126111889 ATGGGCAAGAGGGAGGAGGAAGG - Intergenic
1047723590 8:127665503-127665525 AGTGGTCAGATGAAGGAGATGGG + Intergenic
1047898082 8:129388947-129388969 AGTGATCAGAGCAAGCAGGAGGG + Intergenic
1048237770 8:132708849-132708871 AGTGGTTTGAAGATGGAGGAGGG + Intronic
1048258685 8:132926229-132926251 AGTGGCAAGAGGGCTGAGGAAGG - Intronic
1048289853 8:133172426-133172448 AGTGTTTACAGGAAGGAAGAGGG - Intergenic
1048331045 8:133471010-133471032 CGTGGAAGGAGGAAGGAGGATGG - Intronic
1049026034 8:139989574-139989596 AGGGGAATGAGGAAGGCGGAAGG - Intronic
1049231777 8:141488446-141488468 AGGGGTAGGGGGAAGGAGGGAGG - Intergenic
1049239241 8:141528580-141528602 AGTGGGCAGAGGAGGGAGGAGGG + Intergenic
1049346333 8:142141082-142141104 AGGAGGAAGAGGAAGCAGGAGGG - Intergenic
1049370357 8:142261350-142261372 AGTGGGAGGATGAGGGAGGAGGG + Intronic
1049443557 8:142619866-142619888 GGAGGAAGGAGGAAGGAGGAGGG - Intergenic
1050475915 9:6040960-6040982 AGAAGAAAGAAGAAGGAGGAAGG - Intergenic
1050598043 9:7223764-7223786 AAAGGAAGGAGGAAGGAGGAAGG - Intergenic
1050847415 9:10239816-10239838 AGGGGCAAGAGGCAGGAGGGCGG - Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051589156 9:18758573-18758595 AGTGGGAGGAAGATGGAGGAAGG - Intronic
1051801486 9:20939368-20939390 GGTGGTAAGAGGAGGCAGGAGGG - Intronic
1052370869 9:27663179-27663201 AATGGCAAGGGAAAGGAGGATGG - Intergenic
1052384663 9:27808817-27808839 AGTGCTTACAGGAAGGAGGGTGG + Intergenic
1052820172 9:33132220-33132242 AGTGGGAAGAGGAGGGAGGGAGG + Intronic
1052901268 9:33796616-33796638 AGTGGAAATAGGAAGGGAGAAGG - Intronic
1052947344 9:34179023-34179045 GGCGGTGAGGGGAAGGAGGAGGG + Exonic
1052968135 9:34357847-34357869 GCAGGAAAGAGGAAGGAGGAAGG - Intergenic
1053311619 9:37024369-37024391 AGTGGTAGGGGGACGGAGGCAGG + Intronic
1054354326 9:64047047-64047069 AGTTATAATAGGAAGGAGGGTGG - Intergenic
1054787722 9:69224807-69224829 AGAGGTAACAGGAAGGGTGATGG - Intronic
1054809253 9:69421903-69421925 AGTGGAAGGCGGAAGGCGGAAGG - Intergenic
1055046481 9:71930954-71930976 AGTGGGAAGAGTGAGGAAGAAGG + Intronic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055270329 9:74550589-74550611 AGTGGTAATTGAAAGGTGGAAGG - Intronic
1055592518 9:77832435-77832457 ACTTGGAAGAGGATGGAGGAAGG + Intronic
1055642775 9:78333432-78333454 AGCTCTAAGAGGAGGGAGGAGGG - Intergenic
1055863801 9:80788012-80788034 AGTGGTAAGAGGTAGGACTGTGG - Intergenic
1055877253 9:80958401-80958423 AGAGGGAAAAGGACGGAGGAAGG - Intergenic
1056678647 9:88697830-88697852 AGAGGAAAGGGGAAGGAAGACGG - Intergenic
1057175375 9:92993606-92993628 TGGGGTAAGGGGAGGGAGGAGGG - Intronic
1057294017 9:93825015-93825037 AGTGGGCAGAGTGAGGAGGAAGG - Intergenic
1057451123 9:95161263-95161285 ACAGGAAGGAGGAAGGAGGAAGG + Intronic
1057538119 9:95936083-95936105 AGTGGTAATAGGAATGGAGAAGG + Intronic
1058343425 9:103926719-103926741 AGAGGAAGGAGGGAGGAGGAAGG + Intergenic
1058742182 9:107954903-107954925 AGAGGAAAGAGGAGGAAGGAGGG - Intergenic
1058749246 9:108022935-108022957 AGTGGAAGGAAGAGGGAGGAGGG + Intergenic
1058822123 9:108742223-108742245 ATCGGTAAGAGGAATGAGGCCGG - Intergenic
1059354246 9:113687123-113687145 GGAGGGAAGAGGGAGGAGGAAGG + Intergenic
1059354291 9:113687288-113687310 GGAGGGAAGAGGGAGGAGGAAGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059384168 9:113950988-113951010 AGTGGGAGGGGAAAGGAGGAAGG + Intronic
1059433641 9:114264218-114264240 TGTGGGAAGTGGGAGGAGGAGGG + Intronic
1059650991 9:116315719-116315741 AGGAGTAAGAGGAAGAAAGATGG + Intronic
1059823202 9:117997109-117997131 AGAGGAAGGAGGAAGGAGGAAGG - Intergenic
1059926777 9:119217783-119217805 GGAGATAAGAGGAAGGAGGGAGG - Intronic
1060006860 9:120008073-120008095 AGTGGGAAGAGAGAGGAGCATGG + Intergenic
1060202607 9:121660450-121660472 AGTGGGAAGAGGGAGCAGGGAGG + Intronic
1061086964 9:128405106-128405128 TGTGGCCAGGGGAAGGAGGAGGG - Intergenic
1061216791 9:129226264-129226286 AGGGGAAAGAGGGAGAAGGAGGG + Intergenic
1061313616 9:129779965-129779987 AGGGGAGGGAGGAAGGAGGAAGG + Intergenic
1061408453 9:130405434-130405456 AGTGCTGAGGGGAAGGAGGTTGG - Intronic
1061427903 9:130512176-130512198 AGAGGTGAGAGGGAGCAGGAGGG - Intergenic
1061597747 9:131643098-131643120 AGTGGTCAGGGGAAGGATGAGGG + Intronic
1061772264 9:132934992-132935014 AGTGGTTAGAGGAAGATGGGAGG - Intronic
1062097958 9:134712417-134712439 AGGGGGAACAGGAAGGAGTAGGG - Intronic
1062099271 9:134719748-134719770 GTTGGTAAGAGGACGGAGGATGG + Intronic
1062164555 9:135100984-135101006 CCTGGGAAGAGGGAGGAGGAAGG - Intronic
1062182262 9:135196758-135196780 AGTGGGAAGAAGAAGAGGGAAGG - Intergenic
1062314580 9:135960516-135960538 AAGGGGAAGAGGAAGGAGAAGGG + Intronic
1062324151 9:136004437-136004459 ACTGGTAAGAGGAAGGAGGGCGG - Intergenic
1062469747 9:136697088-136697110 AGGGGGAGGGGGAAGGAGGAGGG - Intergenic
1062495459 9:136829481-136829503 AGTGGTAAGAGGGAGCTGGCGGG + Exonic
1062522782 9:136965327-136965349 GGTGGAAAGAGGAGGGAGGGAGG + Intergenic
1062607692 9:137355415-137355437 GGAGGAAGGAGGAAGGAGGATGG + Intronic
1062607706 9:137355465-137355487 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607708 9:137355472-137355494 GGAGGAAGGAGGAAGGAGGATGG + Intronic
1062607714 9:137355493-137355515 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607716 9:137355500-137355522 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607718 9:137355507-137355529 GGAGGAAGGAGGAAGGAGGATGG + Intronic
1062607724 9:137355528-137355550 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607726 9:137355535-137355557 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607728 9:137355542-137355564 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607753 9:137355629-137355651 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607755 9:137355636-137355658 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607757 9:137355643-137355665 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607771 9:137355694-137355716 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607773 9:137355701-137355723 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062607775 9:137355708-137355730 GGAGGAAGGAGGAAGGAGGAAGG + Intronic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203742657 Un_GL000218v1:16170-16192 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1203702856 Un_KI270742v1:10751-10773 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1203567442 Un_KI270744v1:103259-103281 AGTAATAATAGGAAGGAGGGTGG + Intergenic
1185627597 X:1493410-1493432 GGAGGAAGGAGGAAGGAGGAGGG + Intronic
1185652362 X:1657715-1657737 GGTGAACAGAGGAAGGAGGAAGG - Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186402629 X:9273773-9273795 ACAGGAAAGAGGAAGAAGGAAGG + Intergenic
1186512351 X:10139265-10139287 AGTGGTGACAGGAGGGAGTAAGG - Intronic
1186520397 X:10201176-10201198 AGTGGTGAGGGGAAGGAGGAAGG + Intronic
1186631641 X:11355769-11355791 AGTGATATGAGGAAGAGGGAGGG + Intronic
1186735840 X:12463070-12463092 TGTGGTAAGCTGAGGGAGGATGG + Intronic
1187421109 X:19134508-19134530 AGAGGTAGGAGGCAGGGGGAAGG - Intergenic
1187591437 X:20721544-20721566 GGAGGGAGGAGGAAGGAGGAAGG - Intergenic
1187668687 X:21646078-21646100 AGTGGGATGAGTAAGGACGAGGG - Intronic
1187750929 X:22464124-22464146 AGAGGAGAGAGGAAGGAGGGAGG - Intergenic
1187783871 X:22862157-22862179 AGGGAAAAGAGGAAGGGGGAAGG + Intergenic
1187818851 X:23263822-23263844 AGTGCTTAGAGGAAAGAGCAGGG - Intergenic
1187955673 X:24516173-24516195 AGAGGTGAGAGAAAGAAGGAAGG - Intronic
1188172437 X:26943910-26943932 AGTGGAAAGTAGGAGGAGGAGGG + Intergenic
1189110596 X:38286083-38286105 AGGGGGAAGAGGAAGGAGAAGGG - Exonic
1189110660 X:38286269-38286291 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110675 X:38286320-38286342 AGGGAGAAGAGGAAGGAGAAGGG - Exonic
1189110794 X:38286716-38286738 AAGGGAAAGAGGAAGGAGAAGGG - Exonic
1189243012 X:39540330-39540352 AGTGGGAAGAGGAAGAAGCTGGG + Intergenic
1189348560 X:40260587-40260609 GGTGGTTAGAGGAAGGAGCCAGG - Intergenic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1189681164 X:43518220-43518242 AGTGGGAAGTGGAGGGAGAAAGG - Intergenic
1190100146 X:47516534-47516556 AGTGACAAGATGAAGGAGAAAGG + Intergenic
1190259163 X:48787147-48787169 GGTGGTAAGAGGATGGAGCTAGG - Intronic
1190420982 X:50284185-50284207 AGGGGGAAGAGAAAGGAAGATGG - Intronic
1190553605 X:51611572-51611594 AGAGGAAAGAGAAAGAAGGAGGG - Intergenic
1190618238 X:52260676-52260698 AGTGCTAAGTGGAAGGGTGAGGG + Intergenic
1190839838 X:54133731-54133753 AGTGTTAAGAGCAGGGAGGTAGG + Intronic
1190932675 X:54962601-54962623 ATTGGGGAGAGGAAGGAAGAGGG + Intronic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191757453 X:64609191-64609213 AGTGGTCAGAGAATGGAGGCAGG + Intergenic
1192065300 X:67879019-67879041 TAAGGTAAGTGGAAGGAGGAAGG + Intergenic
1192194072 X:69016971-69016993 AGAGGAAAGAGTAAGGTGGAGGG - Intergenic
1192207642 X:69106811-69106833 TGTGTTGAGAGGAAGAAGGAGGG + Intergenic
1192430951 X:71111285-71111307 AGTGGGAAGGGCAAGGGGGAGGG - Intronic
1192611931 X:72575331-72575353 ATTGGTGAGAGGGAGGAAGATGG + Intergenic
1194512907 X:94817135-94817157 AGAGGAAAGAGCAAGCAGGAGGG - Intergenic
1195401785 X:104468585-104468607 TGTGCAAAGAGGGAGGAGGATGG + Intergenic
1195520419 X:105822742-105822764 GGAGGAGAGAGGAAGGAGGAGGG - Exonic
1195571408 X:106401939-106401961 ACTGGAAAGAGGACGGAGGTGGG + Intergenic
1195676895 X:107513427-107513449 AATGGCAAGGGGCAGGAGGATGG - Intergenic
1195696219 X:107669582-107669604 TGGGGGAGGAGGAAGGAGGAAGG - Intergenic
1195708192 X:107753214-107753236 AGAGGAGAGAGGAGGGAGGATGG + Intronic
1195965367 X:110425327-110425349 AGTGGGAAGGTGAAGGAAGAAGG - Intronic
1196040817 X:111201532-111201554 GGTGGAAAGAGGTAGAAGGAAGG + Intronic
1196208502 X:112968036-112968058 AGCGGGAAGAGGCAGGAGGCAGG + Intergenic
1196213381 X:113021607-113021629 AGTGGTAAGGCGTAGGTGGAGGG - Intergenic
1196657333 X:118232206-118232228 GGGAGGAAGAGGAAGGAGGAGGG + Intergenic
1196870251 X:120106670-120106692 AGTGGAAAAAGGAAGAAGTAAGG + Intergenic
1196991650 X:121335813-121335835 AGAGGAAGGAGGAAGGTGGAAGG - Intergenic
1197250273 X:124208903-124208925 TGTGGAAAGAGGAAGGAAGAGGG + Intronic
1197423960 X:126272710-126272732 AGTTCCCAGAGGAAGGAGGAGGG - Intergenic
1198066058 X:133097741-133097763 GGTGATAAGAGGACTGAGGAAGG + Intergenic
1198111963 X:133509750-133509772 AGTGGCAGGAGGAATGAGGAGGG + Intergenic
1198311812 X:135432486-135432508 AGAAGGAAGAGGAAGGATGAAGG - Intergenic
1198502039 X:137259944-137259966 AGTGGAAAGAGGAAGGGGACTGG - Intergenic
1198576357 X:138014053-138014075 GGTGGGAAGAAGAAAGAGGAAGG + Intergenic
1198751923 X:139944706-139944728 AGTGATAAAAGGAGGGAGGCAGG - Intronic
1199413799 X:147556605-147556627 AAAGGTAAGAGGAAGGTGAAAGG + Intergenic
1199456125 X:148031119-148031141 ACAGGTAAGAGGAAGTATGAGGG + Intergenic
1199779306 X:151043839-151043861 TGTTGTCAGAAGAAGGAGGAAGG + Intergenic
1199863786 X:151825048-151825070 TGTGGTCAGAGGCAGGAGGCTGG + Intergenic
1199934541 X:152559601-152559623 AGTGATGAGGGGATGGAGGAAGG - Intergenic
1199946243 X:152670538-152670560 AGTGAAAAGAGATAGGAGGAGGG - Intergenic
1200244398 X:154515472-154515494 AGTGGTGAGAGAGAGGAGGTGGG - Intronic
1200258697 X:154600031-154600053 AGGGGGAAGAGCAAGGTGGAGGG + Intergenic
1200304975 X:155015656-155015678 AGAGGAAAGAGGGAGGAGGAAGG + Intronic
1201156190 Y:11133642-11133664 AGTAATAATAGGAAGGAGGGTGG - Intergenic
1201438581 Y:13985438-13985460 AGTGGTGTGGGGAGGGAGGAAGG - Intergenic
1201445992 Y:14057270-14057292 AGTGGTGTGGGGAGGGAGGAAGG + Intergenic
1201587328 Y:15575515-15575537 AGTGTGAAGATAAAGGAGGATGG - Intergenic
1201639713 Y:16165953-16165975 AATGGTCACAGGAAAGAGGAGGG + Intergenic
1201663100 Y:16419371-16419393 AATGGTCACAGGAAAGAGGAGGG - Intergenic
1201710941 Y:16990914-16990936 TGGGGTGAGGGGAAGGAGGAGGG + Intergenic
1202017426 Y:20425256-20425278 AGGGCTGAGAGGAAAGAGGAGGG + Intergenic
1202164753 Y:21975490-21975512 AGTGCAAAGGGGAACGAGGAAGG - Intergenic
1202226603 Y:22610884-22610906 AGTGCAAAGGGGAACGAGGAAGG + Intergenic
1202316516 Y:23584778-23584800 AGTGCAAAGGGGAACGAGGAAGG - Intergenic
1202554248 Y:26085280-26085302 AGTGCAAAGGGGAACGAGGAAGG + Intergenic