ID: 1047413238

View in Genome Browser
Species Human (GRCh38)
Location 8:124641278-124641300
Sequence CAAGTTGCTCACAGGTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047413238 Original CRISPR CAAGTTGCTCACAGGTATAT GGG (reversed) Intronic
903016076 1:20362694-20362716 CAAGTTGCTCATAGTTTGATGGG - Intergenic
903785455 1:25858373-25858395 CAGGTTGCTCACAGTCTTATAGG - Intronic
904650385 1:32001224-32001246 CATATTGCTCAAAGGTATTTTGG + Intergenic
905707287 1:40070425-40070447 CAAGTTTCTTACAGTTATCTAGG - Exonic
910874354 1:91864324-91864346 CAAATTGCTGACAAGAATATTGG + Intronic
916865504 1:168852731-168852753 GAAGTTTCTCAAATGTATATAGG + Intergenic
916980139 1:170127030-170127052 CTAGTAAATCACAGGTATATGGG - Intergenic
917511422 1:175672286-175672308 CATGTTGGCCACAGGTAGATAGG - Intronic
922987360 1:229876210-229876232 AAAGTTAATCACAGGTATGTAGG - Intergenic
923187319 1:231586768-231586790 CAAGATGCTGACAGGTTCATGGG + Intronic
924105652 1:240646493-240646515 AAAGTTGCTCAGAGCTTTATAGG - Intergenic
1063247152 10:4233489-4233511 CAAGTTTTACACAGGTATTTGGG - Intergenic
1068850163 10:61729337-61729359 CAAATAGCCAACAGGTATATGGG + Intronic
1069694826 10:70378983-70379005 CAAGCTGCCCACAGGTCAATGGG - Intronic
1071140303 10:82501583-82501605 CAAGAGGCTCCCCGGTATATTGG - Intronic
1073625898 10:105096468-105096490 CAAGTAGCTCACAGGCTAATGGG + Intronic
1074585291 10:114762370-114762392 CAAGGAGCTCACAGTTTTATGGG - Intergenic
1075165229 10:120062210-120062232 CAAATGGCCCACAGGTACATTGG + Intergenic
1075841304 10:125506503-125506525 CACGTTCCGCACATGTATATTGG + Intergenic
1081553897 11:44139844-44139866 CAGTTTGCTGACAGCTATATGGG + Intronic
1084459895 11:69290896-69290918 CCAGTTGCTCACAGGCAGAAGGG + Intergenic
1087547292 11:99600848-99600870 CAAGAAGCTCAAAGGTATTTTGG + Intronic
1088202368 11:107352342-107352364 CAAGTTGCTTACAGCTTTATGGG - Intronic
1088526452 11:110761437-110761459 CAAGTTGCTCAAAGTTATGCAGG + Intergenic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1102103674 12:110301426-110301448 CAAGTTTCTCACAGTTAATTAGG - Intronic
1107231983 13:38120881-38120903 CAAGTTGTTCAAAGGTCAATTGG - Intergenic
1107738718 13:43425591-43425613 CTAGTTGCTCAGAGGCAGATGGG - Intronic
1108543642 13:51468527-51468549 GAATTTGCTCACAGGAAAATGGG + Intergenic
1110199911 13:72837405-72837427 CAAGTAGCTCAAAGAAATATTGG + Intronic
1111101214 13:83589491-83589513 CAAGCATCTCACAAGTATATTGG - Intergenic
1113954846 13:114093418-114093440 GAAGTTGCTGCTAGGTATATTGG + Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1117519477 14:56536063-56536085 CAAATTGCATTCAGGTATATGGG + Intronic
1118555085 14:67009332-67009354 CAAGTAGCTCACAGGAATATAGG + Intronic
1120019026 14:79507336-79507358 CAAGTTGGTGAAAGGTACATAGG + Intronic
1122122970 14:99564386-99564408 CAAGGTGGGCACAGGCATATGGG - Intronic
1122564221 14:102640426-102640448 CAAGATGATGACAGGTATCTTGG + Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1129552130 15:76463911-76463933 CAATTTGCTCATCAGTATATTGG + Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1132457312 16:31264-31286 CAAGTTGCTCACTGGTGCCTGGG + Intergenic
1144357771 17:14462294-14462316 TAATTTGCTCACAGTTCTATAGG + Intergenic
1147665864 17:42147664-42147686 AAAGTTGCTCACAGACAAATGGG - Intronic
1151334285 17:73430935-73430957 CAAGTGGCCCACAGGTATGCTGG + Intronic
1152064641 17:78103988-78104010 TCAGTTCCTCACAGGTATCTTGG + Intronic
1152961324 18:82066-82088 CAAGTTGCTCACTGGTTCCTGGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156034764 18:32753937-32753959 CAACTTCCTCACAGGGATGTGGG - Intronic
1159669141 18:71201143-71201165 CAGGTTGGTAACAGGTATACAGG + Intergenic
1160457248 18:79010623-79010645 TAAGTTGCTCACAGTTTTATTGG + Intergenic
1160622779 18:80182192-80182214 CCAGTTGGTCACAGGCATTTTGG - Intronic
1163361802 19:16851530-16851552 CATGTGGCTCACAGGTACCTTGG - Exonic
1164487474 19:28671945-28671967 CAACTTTCTCACAGAAATATTGG - Intergenic
925516509 2:4689519-4689541 CAATTGGCTCACAGTTTTATAGG + Intergenic
926903382 2:17782634-17782656 CCAGAAGTTCACAGGTATATCGG + Exonic
931248775 2:60512396-60512418 CATCTTGCTCTCAGGTATAAAGG + Intronic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
938798325 2:134737336-134737358 CAAGTTTCTCACTTGTAAATTGG - Intergenic
939705386 2:145446574-145446596 AAACTTGGCCACAGGTATATAGG - Intergenic
1170013006 20:11748096-11748118 CAAGTTGCCGACAGATATTTTGG - Intergenic
1170088953 20:12568865-12568887 CATGTTCCTCATAGGTATAGTGG + Intergenic
1170275391 20:14581019-14581041 CAAACTGCCCACAGGTAGATTGG - Intronic
1172295230 20:33805290-33805312 CAAGTTGCTCCCAGGTACATAGG - Intergenic
1173882028 20:46422609-46422631 CAAGTAGCTCACAGTATTATCGG - Intronic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
949769636 3:7565615-7565637 CAAATTGTGCACAGTTATATGGG + Intronic
950696513 3:14704847-14704869 CAAGCTTCTCACAGGTAGCTGGG - Intronic
951374945 3:21902427-21902449 CAAGGTGATCACCGGTATCTTGG + Intronic
951972947 3:28468601-28468623 CAGTTTGCTGACAGGTATATCGG - Intronic
952950981 3:38525182-38525204 CAATTTTCTCACAGGTAAAATGG - Exonic
956212146 3:66813148-66813170 CCACTTGCTCACTGGTATATAGG + Intergenic
962521969 3:136205574-136205596 GAAGGTGGTAACAGGTATATAGG + Intergenic
962587537 3:136857813-136857835 CTAGTTTCTCACAGATATAATGG + Intergenic
968291311 3:197541864-197541886 CCAGCTGTTCACAGGGATATTGG - Intronic
970843450 4:20504924-20504946 AAACTTGATCACAGGCATATAGG + Intronic
976903841 4:90211443-90211465 AGTGTTGCTCACAGGTATATAGG + Intronic
980642922 4:135603020-135603042 CAAGTTTCTCACAGATTTGTAGG - Intergenic
981226970 4:142308194-142308216 CAAGTGGCTGACAGTTATAATGG - Intronic
1202752065 4_GL000008v2_random:15809-15831 CTAGTTGCTCAAATGTATGTGGG + Intergenic
995555974 5:113329079-113329101 CAAATTTCTCACGGGTAAATGGG + Intronic
996069095 5:119113997-119114019 CAAGTATCTAACAAGTATATAGG + Intronic
996758568 5:126962978-126963000 CAAGTTGCCCACAGTTACACAGG - Intronic
996761973 5:126995283-126995305 CCAGTTGCACACTGGTACATTGG - Intronic
997985406 5:138497358-138497380 CCAGTTGGCCATAGGTATATGGG + Intergenic
1000037253 5:157458771-157458793 GAAGCTGGTGACAGGTATATGGG + Intronic
1004594197 6:17083738-17083760 CAAGTTGATAATATGTATATTGG - Intergenic
1007204794 6:40140202-40140224 CAAGTTGCTCACATGTTGGTGGG - Intergenic
1008199848 6:48572802-48572824 AAAGTTTCTTACAAGTATATGGG + Intergenic
1009758720 6:67976461-67976483 GAATTTGTTCACAGGTATAATGG + Intergenic
1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG + Intronic
1015574225 6:134653811-134653833 CTATTTGCTTACATGTATATTGG + Intergenic
1017638791 6:156470124-156470146 CAAATGGCCAACAGGTATATAGG + Intergenic
1028201553 7:87967865-87967887 CAAGGTGCTTACAGAGATATTGG + Intronic
1030729548 7:112969748-112969770 TAAGTTACTCACAAATATATAGG - Intergenic
1034883206 7:154778232-154778254 CATGGTGCTCACAGGAAAATAGG - Intronic
1037315643 8:17596301-17596323 CAGGCTGCTCACAGGCACATGGG + Intronic
1037940296 8:22946149-22946171 CTAGTTGCACACTGGTATAGTGG - Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040886798 8:52272422-52272444 CAAATGGCCAACAGGTATATAGG + Intronic
1042034573 8:64517902-64517924 CAAGTTGCACAATGGTTTATTGG - Intergenic
1044329826 8:90904641-90904663 AAATTTGCTTAGAGGTATATTGG - Intronic
1044985782 8:97755429-97755451 CAACTTGCCCACAGGTACACAGG + Intergenic
1047413238 8:124641278-124641300 CAAGTTGCTCACAGGTATATGGG - Intronic
1048815232 8:138327324-138327346 CAGGTTCCTCATAGGAATATTGG - Intronic
1049040123 8:140106304-140106326 AAAGTTGCTGACAGGTACCTAGG + Intronic
1056067443 9:82951431-82951453 AAATTTGCTCACATGTCTATGGG - Intergenic
1056325307 9:85473431-85473453 CATGTTGCCCTCAGGTCTATAGG - Intergenic
1057773720 9:97988236-97988258 CAGGTTGTTCACAGGGATTTTGG + Intronic
1058722156 9:107773933-107773955 CAAAATGCTGACAGTTATATGGG - Intergenic
1062736834 9:138142070-138142092 CAAGTTGCTCACTGGTTCCTGGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1190020109 X:46866558-46866580 TAAGTTTCTCACAGGGGTATGGG - Intronic
1190620442 X:52282148-52282170 AAAGTAGCTCACAGATATACAGG - Intergenic
1193185238 X:78503705-78503727 CAGTTTGCTGCCAGGTATATTGG - Intergenic
1195222998 X:102764114-102764136 CTAGTAGCTCACAGGTCTGTAGG - Intergenic
1195617582 X:106925041-106925063 CAAGTAGCTCACAGGCTAATAGG + Intronic
1195929679 X:110062301-110062323 CTATTTTCTAACAGGTATATTGG - Intronic
1198684183 X:139210229-139210251 CAATTTGCTCACAAGTCTGTGGG - Intronic
1200399046 X:156008121-156008143 CAAGTTGCTCACTGGTGCCTGGG - Intronic
1200406130 Y:2813377-2813399 CATGTAGCTCACAGTTCTATGGG + Intergenic