ID: 1047413690

View in Genome Browser
Species Human (GRCh38)
Location 8:124645831-124645853
Sequence CCACTTAAGCCGAGGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047413690_1047413694 5 Left 1047413690 8:124645831-124645853 CCCAGCTTCCTCGGCTTAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1047413694 8:124645859-124645881 GCAACAATCTTTGCTCTTTCAGG No data
1047413690_1047413695 6 Left 1047413690 8:124645831-124645853 CCCAGCTTCCTCGGCTTAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1047413695 8:124645860-124645882 CAACAATCTTTGCTCTTTCAGGG No data
1047413690_1047413696 14 Left 1047413690 8:124645831-124645853 CCCAGCTTCCTCGGCTTAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1047413696 8:124645868-124645890 TTTGCTCTTTCAGGGCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047413690 Original CRISPR CCACTTAAGCCGAGGAAGCT GGG (reversed) Intronic
900216194 1:1482914-1482936 TCACTTAAGCCCAGGAGGTTTGG + Intronic
901606498 1:10463319-10463341 CCACTGAAGCCGCGGCTGCTGGG - Intronic
901756437 1:11444247-11444269 CCACTCAGGCCAAGGAAGGTCGG + Intergenic
901763614 1:11486399-11486421 CTTCTTTAGCCGGGGAAGCTGGG + Intronic
902182649 1:14701203-14701225 TCACTTAAGCCCAGGAGGTTGGG - Intronic
905303973 1:37004992-37005014 GCACTTAAGCCCAGGAAACAAGG - Intronic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
906483860 1:46219860-46219882 CCGCTCAAGGCGAGGCAGCTGGG + Exonic
907285714 1:53378216-53378238 CCACTAGAGCCGAGGCACCTGGG - Intergenic
909966300 1:81915158-81915180 TCACTTGAGCCTGGGAAGCTGGG - Intronic
915183280 1:154081896-154081918 TCACTTAAGCCCAGGAAGTGAGG + Intronic
915846841 1:159275565-159275587 GCACTTAAGGAGAGGAAGCTAGG - Intergenic
917199515 1:172500089-172500111 CCACTTCAGCTGAGGAGGCTGGG + Intergenic
922196191 1:223362957-223362979 CCACTTTGGCCAAGGAAGCGGGG - Intronic
924375168 1:243400017-243400039 GCACTGAAGCCTAGGCAGCTAGG + Intronic
1063670019 10:8092788-8092810 CCACTTCAGCTCTGGAAGCTTGG - Intergenic
1064993315 10:21275391-21275413 CCACTTAAGGTCTGGAAGCTGGG - Intergenic
1071437479 10:85660673-85660695 CCTCTTAAGCAGAGGAAACAAGG + Intronic
1072086865 10:92088309-92088331 CCACTTGAGCCCAGGGAGCTCGG - Intronic
1075710470 10:124527986-124528008 TCACTTGAGCCCAGGAGGCTGGG - Intronic
1076262439 10:129078451-129078473 CCACTTAAATTTAGGAAGCTGGG - Intergenic
1083862137 11:65426778-65426800 CCACTCAAGCCAATGAAGGTGGG + Intergenic
1085919248 11:80932100-80932122 TCACTTGAGCCCAGGAAGCTGGG + Intergenic
1089228866 11:116951847-116951869 TTACTTGAGCCCAGGAAGCTGGG + Intronic
1090588087 11:128236039-128236061 CTACTTAGGCCGAGGAAGCCTGG - Intergenic
1091328626 11:134712841-134712863 CCACCTAAGGCGAAGAAGCCGGG + Intergenic
1093339138 12:17949878-17949900 CCACTTCAGCCCAGGAACCAGGG - Intergenic
1098357886 12:69628128-69628150 TCACTTAAGCCCAGGAGGCAGGG + Intergenic
1100259998 12:92924024-92924046 CCACTTGAGCCCAGGAGGCAGGG + Intronic
1101126441 12:101640125-101640147 CCACTTCAGCCCAAGTAGCTGGG + Intronic
1101335581 12:103793692-103793714 CCACTTAGACCGAGGAGGCAGGG - Intronic
1107282787 13:38755720-38755742 CCACCTAAGCACAGGAAGATGGG + Intronic
1110255381 13:73427905-73427927 CCCCTAAAGCCCAGGAAGCTGGG - Intergenic
1118766630 14:68914100-68914122 CCACTTAAGCCTGAGTAGCTGGG - Intronic
1119905770 14:78300641-78300663 CCAATTAAGTAGAGGAAGCATGG - Intronic
1122859614 14:104576661-104576683 CCACTGTAGCAGAGGGAGCTGGG + Intronic
1124606516 15:31173433-31173455 CCACTTAAGAAGAGGAAATTTGG - Intergenic
1124877116 15:33605376-33605398 CCTCTGAAGGCAAGGAAGCTGGG + Intronic
1125660160 15:41387813-41387835 CCACTTAAGACTAGGAAGGACGG + Intronic
1126018532 15:44376348-44376370 TCACTTGAGCCCAGGAGGCTAGG - Intronic
1130437998 15:83921767-83921789 TCACTTCAGCCCAGGAGGCTGGG - Intronic
1131518612 15:93096576-93096598 CCACCTCAGCCTAGGTAGCTGGG + Intergenic
1132261930 15:100433518-100433540 CCAATTGAGCCAAGGAGGCTGGG - Intronic
1135925340 16:26689169-26689191 CCTCGGAAGCCGAGGAAGCATGG - Intergenic
1136361968 16:29786404-29786426 TCACTTGAGCCCAGGAGGCTAGG - Intergenic
1136465324 16:30439169-30439191 TCACTTAAGCCCAGGAGGCGGGG - Intergenic
1138318496 16:56090764-56090786 CCACTTCAGGTGAGGAATCTGGG + Intergenic
1141238770 16:82245056-82245078 CCACCTCAGCCCAGGTAGCTGGG - Intergenic
1143663633 17:8343214-8343236 TCACTTGAGCCCAGGAAGCAGGG - Intronic
1145046009 17:19616853-19616875 TCACCTAAGCCCAGGAAGTTGGG + Intergenic
1146209318 17:30929779-30929801 TCACTTGAGCCGAGGAGGTTGGG - Intronic
1146550048 17:33772662-33772684 CCACTTTAGACGAGGAAGAAAGG + Intronic
1151463394 17:74269053-74269075 TCACTTAAGCCCAGGAATTTGGG + Intergenic
1164923190 19:32104985-32105007 CCACTTACCACGAGGAAGCTCGG - Intergenic
928789784 2:34936244-34936266 CCACCCAAGCCGAGGAAACCCGG - Intergenic
932917025 2:75870711-75870733 TCACTTAAGCCCAGGAATTTGGG + Intergenic
933662827 2:84941650-84941672 TCACTTGAGCCCAGGAGGCTGGG + Intergenic
935973212 2:108551042-108551064 TCACTTGAGCCCAGGAAGTTGGG + Intronic
945001611 2:205356804-205356826 CCGCTTAAACCCAGGAAGCAGGG + Intronic
1169273216 20:4216532-4216554 CCACTTGGGCCGAGGGAGCACGG + Intergenic
1169570513 20:6900453-6900475 CCACTTACTAAGAGGAAGCTCGG - Intergenic
1172567125 20:35939275-35939297 CCACTTAAGCCAAAGATCCTTGG + Intronic
949788941 3:7771828-7771850 CCACCTAAGCTGAGGCTGCTTGG + Intergenic
951454798 3:22878496-22878518 CCACTTGAGACAAGGCAGCTGGG - Intergenic
953870372 3:46620988-46621010 AGCCTTAAGCTGAGGAAGCTGGG + Intronic
958617754 3:96517162-96517184 CATCTTAACCAGAGGAAGCTGGG + Intergenic
960002512 3:112748131-112748153 CCACCTAAGCCAAGGATGCTGGG + Intronic
964988166 3:162771135-162771157 CCACTTGAGCTGATGTAGCTTGG - Intergenic
970540406 4:17072565-17072587 CAACTTAAGCCGAGGATACTGGG - Intergenic
973289431 4:48455604-48455626 CCACTCAAGAAGAGGAAACTTGG + Intergenic
977934500 4:102785815-102785837 CCACTTCAGCCCAAGTAGCTGGG + Intergenic
980621034 4:135304035-135304057 GCAATTAAGCCAAGCAAGCTTGG + Intergenic
980932118 4:139192133-139192155 TCACTTGAGCCCAGGAAGTTGGG - Intergenic
981310849 4:143296658-143296680 CCACTTCAGCCTAAGTAGCTAGG - Intergenic
986948815 5:13057476-13057498 TCACTTGAGCCCAGGAAGCAGGG - Intergenic
988952339 5:36276080-36276102 ACAGTTAAGCCCAGGAAGCAAGG - Intronic
992112156 5:73505429-73505451 CTAATTAAGCCGAAGAAGCCTGG + Exonic
992286494 5:75240989-75241011 TCACTTGAGCCGAGGAGCCTGGG + Intergenic
992831221 5:80595348-80595370 CCACTTAAGCCTAGGAGGTCAGG - Intergenic
995282491 5:110351936-110351958 CCACTTAAGGTGAGGGAGATGGG - Intronic
999342695 5:150786370-150786392 TCACTTGAGCCCAGGAGGCTAGG - Intronic
1003058032 6:2840894-2840916 CCACTAAAGCTGGGGTAGCTGGG - Intronic
1007010295 6:38410386-38410408 TCACTTGAGCCCAGGAGGCTGGG + Intronic
1008545606 6:52580555-52580577 TCACTTAAGCCCAGGAGGTTGGG - Intergenic
1010211253 6:73364053-73364075 TCACTTAAGTCCAGGAAGCTGGG + Exonic
1015666454 6:135635235-135635257 TCACTTAAGCCTAGGAATTTGGG + Intergenic
1016433713 6:144013664-144013686 CCAAGGAAGCCGAGGAAGCCAGG - Intronic
1018896418 6:168021363-168021385 CCTCTGAAGCAGCGGAAGCTGGG - Intronic
1019032283 6:169024024-169024046 CCTGTGAAGCCGAGGAAGCTCGG - Intergenic
1019695369 7:2443004-2443026 CCACTTGAACCCAGGAAGCAGGG - Intergenic
1022166004 7:27762866-27762888 TCACTTGAGCCCAGGAGGCTGGG + Intronic
1022398548 7:30013815-30013837 GGACTTAAGCTGATGAAGCTTGG - Exonic
1027198721 7:76048846-76048868 CCACTTAAGCCTAGGAGCCTAGG + Intronic
1027622300 7:80504229-80504251 TCACTTGAGCCCAGGAAGTTGGG + Intronic
1030204508 7:106939878-106939900 CCAGAAAAGCAGAGGAAGCTTGG + Intergenic
1030986228 7:116244951-116244973 CCACTGGAGCTGAAGAAGCTGGG + Intronic
1034144767 7:148859419-148859441 TCACTTGAGCCCAGGAAGCAGGG + Intronic
1036489172 8:9209022-9209044 TCACTTGAGCCCAGGAGGCTTGG - Intergenic
1036710848 8:11077677-11077699 CCACTTAATAAGAGGGAGCTGGG - Intronic
1041026180 8:53689160-53689182 CCAATTAACTGGAGGAAGCTGGG - Intergenic
1046286447 8:112099094-112099116 TCACTTTAACCGAGGAAGCGGGG - Intergenic
1047413690 8:124645831-124645853 CCACTTAAGCCGAGGAAGCTGGG - Intronic
1048925231 8:139265425-139265447 CCACCCAAGCTGGGGAAGCTGGG - Intergenic
1055979580 9:81988897-81988919 CCACTCAAGCAGATGAAGTTGGG - Exonic
1056384281 9:86082523-86082545 TCACTTGAGCCCAGGAAGTTGGG - Intronic
1056631419 9:88296102-88296124 TCACTTGAGCTGAGGAGGCTGGG - Intergenic
1059236238 9:112762895-112762917 CCACTCCAGGTGAGGAAGCTGGG + Intronic
1185912029 X:3990288-3990310 TCACTTCAGCCTAGGAGGCTGGG - Intergenic
1187373546 X:18730390-18730412 CATTTTAAGCTGAGGAAGCTTGG + Intronic
1190182205 X:48202564-48202586 TCACTTGAGCTGAGGAGGCTGGG - Intronic
1190195337 X:48313296-48313318 TCACTTGAGCAGAGGAGGCTGGG - Intergenic
1190196148 X:48320169-48320191 TCACTTGAGCTGAGGAGGCTGGG + Intergenic
1190661785 X:52661518-52661540 TCACTTGAGCTGAGGAGGCTGGG - Intronic
1190662854 X:52670516-52670538 TCACTTGAGCTGAGGAGGCTGGG + Intronic
1190676569 X:52787966-52787988 TCACTTGAGCTGAGGAGGCTGGG - Intronic
1199136639 X:144261368-144261390 TCACTTAAGCCCAGGAACCGAGG + Intergenic