ID: 1047423305

View in Genome Browser
Species Human (GRCh38)
Location 8:124725011-124725033
Sequence TGTTGTGCAAAATCACCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047423305_1047423312 20 Left 1047423305 8:124725011-124725033 CCAGTAGGTGATTTTGCACAACA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1047423312 8:124725054-124725076 CCACAGCAGGGTAGAATAAACGG No data
1047423305_1047423313 21 Left 1047423305 8:124725011-124725033 CCAGTAGGTGATTTTGCACAACA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1047423313 8:124725055-124725077 CACAGCAGGGTAGAATAAACGGG No data
1047423305_1047423308 8 Left 1047423305 8:124725011-124725033 CCAGTAGGTGATTTTGCACAACA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1047423308 8:124725042-124725064 TAGCGACCACCACCACAGCAGGG No data
1047423305_1047423307 7 Left 1047423305 8:124725011-124725033 CCAGTAGGTGATTTTGCACAACA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 1047423307 8:124725041-124725063 TTAGCGACCACCACCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047423305 Original CRISPR TGTTGTGCAAAATCACCTAC TGG (reversed) Intronic
905578105 1:39062215-39062237 TGTTATGAAAAATCATGTACAGG - Intergenic
906188168 1:43877562-43877584 TCTTGTCCAAGATCTCCTACTGG - Intronic
906272654 1:44493178-44493200 TGTTGTGTAAAATTACCTTCAGG + Intronic
907534294 1:55135485-55135507 TGTTGTATAAAATTACCTTCAGG + Intronic
907622270 1:55993484-55993506 TGTTGTCCAAAATCAGCAACAGG + Intergenic
910145266 1:84072549-84072571 TATTGTGTAAAATTACCTTCAGG + Intergenic
910729595 1:90379894-90379916 TATTGTGTAAAATTACCTCCAGG + Intergenic
918418896 1:184341704-184341726 TGATATACCAAATCACCTACTGG + Intergenic
1069324603 10:67217982-67218004 TGTTGTATAAAATTACCTTCAGG + Intronic
1070022186 10:72597703-72597725 TGTTGTATAAAATAACCTTCAGG - Intronic
1070047641 10:72854808-72854830 TGTGGTGCAAAAGCAGCCACAGG - Intronic
1070786936 10:79167428-79167450 TGCTCTGCAAACTCACCTGCAGG - Intronic
1071011167 10:80942262-80942284 TGTTCTCCTAAATCACCTCCTGG - Intergenic
1072093359 10:92151452-92151474 TTTTGTTCAAAGTCACCTACTGG - Intronic
1072823650 10:98583956-98583978 TGCTATAAAAAATCACCTACAGG + Intronic
1073965484 10:108984282-108984304 TGTTGTATAAAATTACCTTCAGG - Intergenic
1077900393 11:6482671-6482693 TGTTGTATAAAATGACCTTCTGG - Exonic
1079088128 11:17461712-17461734 TGCTGTCCAAAGGCACCTACTGG - Exonic
1080165388 11:29230352-29230374 TGCTGTACAAAATTACCTTCAGG - Intergenic
1083446718 11:62712811-62712833 GGTTGTGCAAAAACATTTACAGG + Exonic
1084674753 11:70627716-70627738 TGTTGTATAAAATTACCTTCAGG - Intronic
1086670228 11:89537742-89537764 TGTTGTACAAAGTCAACTCCAGG - Intergenic
1088227084 11:107633018-107633040 TGTTGTATAAAATTACCTTCAGG + Intronic
1090176671 11:124656016-124656038 TATTGTACAAAATTACCTTCAGG + Intronic
1091927253 12:4363626-4363648 TATTGTGCAAAATTACCTTCAGG + Intergenic
1097292192 12:57926949-57926971 TATTGTGTAAAATTACCTTCAGG - Intergenic
1099744758 12:86688394-86688416 TAATGTGCAAAATCACCAGCTGG - Intronic
1101088154 12:101257204-101257226 TGTTGTGTAAAATCAGCCCCTGG + Intergenic
1102835267 12:116051701-116051723 TATTGTGCAAAATTACCTTCAGG - Intronic
1107969054 13:45623551-45623573 TGTTGTGCAAACACAGCTTCAGG + Intergenic
1112056943 13:95698213-95698235 TGTTGTGCAATTCAACCTACAGG + Intronic
1113786600 13:113005206-113005228 TGCTGAGCAAAATCAGCCACAGG + Intronic
1114942533 14:27632140-27632162 TGTTGTGAAAAATCTCCTGGAGG + Intergenic
1115646937 14:35375039-35375061 TGTTTTGCCAAATTACCTAAGGG + Intergenic
1115732874 14:36290497-36290519 TATTGTACAAAATTACCTTCAGG + Intergenic
1116842837 14:49836878-49836900 TATTGTATAAAATCACCTCCAGG - Intronic
1117166929 14:53044761-53044783 TGTTGTGCAAATTCAGCAAAAGG + Exonic
1117217916 14:53570861-53570883 TGTGCTGCAGAATCAGCTACAGG + Intergenic
1118268785 14:64321929-64321951 TGGGATGCAAAATCACCTATTGG + Intronic
1118392872 14:65310459-65310481 TATTGTACAAAATTACCTTCAGG + Intergenic
1120645287 14:87067004-87067026 TGTTTTGCAAAAACCCGTACAGG - Intergenic
1120659256 14:87233056-87233078 TGTGCTTCAAAATCACCTACCGG + Intergenic
1120880467 14:89412007-89412029 TATTTTGCAAATGCACCTACTGG - Exonic
1123103659 14:105824811-105824833 TATTGTACAAAATCACCTTCAGG - Intergenic
1123838533 15:24222689-24222711 TCATGTGCAAAATCAACTTCAGG - Intergenic
1126171669 15:45700361-45700383 TGTTGTACAAAATTATCTTCAGG + Intergenic
1127249640 15:57218928-57218950 TCTTGTACAAAATCACTTCCTGG - Intronic
1128615763 15:69108115-69108137 TGTTATGCAAAATAATTTACTGG + Intergenic
1133464469 16:6017251-6017273 TTTTGTGCAAATTCACCAACAGG - Intergenic
1134094220 16:11408404-11408426 TGTTTTGCAAAATAACTTCCTGG + Intronic
1135813649 16:25612220-25612242 TGTTGTGTAAAACTACCTTCAGG - Intergenic
1136370595 16:29833744-29833766 TGTTGGGCAGAACCACCTGCAGG - Exonic
1137243290 16:46678178-46678200 TATGGTGCAAAAGCACCCACAGG - Intronic
1137612647 16:49829200-49829222 TGTTGTGTAGAATGACCAACTGG + Intronic
1138639470 16:58372039-58372061 TGTTGTGCAATATCACAACCAGG + Intronic
1138690044 16:58758614-58758636 TGTTGTATAAAATTACCCACAGG + Intergenic
1139612352 16:68068119-68068141 TGCTGTACAAAATCACATCCTGG - Intronic
1140400772 16:74669620-74669642 TGTTGGGAAAAATCAGGTACAGG + Intergenic
1140808689 16:78556645-78556667 TGTTGTGCAAAATCACACACCGG - Intronic
1203105594 16_KI270728v1_random:1353662-1353684 TATAATGCAAAATCACCTAAAGG - Intergenic
1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG + Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1147291547 17:39447458-39447480 TGTTGTATAAAATTACCTTCAGG + Intronic
1148548042 17:48531571-48531593 GGTGGTGCAAAAACACCTAAGGG + Intergenic
1149402379 17:56311717-56311739 TGTTGTATAAAATTACCTTCAGG + Intronic
1149945861 17:60925960-60925982 TATTGTACAAAATCACCTTCAGG - Intronic
1156703006 18:39846997-39847019 TGTTGAGCAGAATCACCTTGAGG - Intergenic
1159266216 18:66083216-66083238 TGTTGAGCAAAATGACACACAGG - Intergenic
1159295851 18:66487487-66487509 TCATGTGCAAAATCAATTACAGG - Intergenic
1159589527 18:70318208-70318230 TTTTCTGCAGAATCACGTACAGG - Intronic
1159607128 18:70486445-70486467 TGCTATGAAAAATCACTTACAGG - Intergenic
1164699801 19:30276924-30276946 TGTTGTGCAAAAGCAACATCTGG - Intronic
1164961210 19:32431682-32431704 TATTGTATAAAATCACCTTCAGG - Intronic
1165137002 19:33675830-33675852 TTTTGTGCAAAATCAGCTGAGGG - Intronic
925089317 2:1140972-1140994 TTAAGTTCAAAATCACCTACAGG - Intronic
928950809 2:36811593-36811615 TGTTGTACAGAATCTCCTACTGG - Intronic
931212652 2:60212549-60212571 TGTTGTTCAAAAGTACCTATTGG - Intergenic
934865672 2:97808129-97808151 TGTTGTATAAAATTACCTTCAGG - Intronic
935189208 2:100762443-100762465 TGTAGTGCAAAAGCAGCCACAGG - Intergenic
935251915 2:101270259-101270281 TGTTGTCCAAAATCACATAAAGG - Exonic
936069916 2:109360441-109360463 TGTTGTATAAAATTACCTTCAGG + Intronic
936708548 2:115104011-115104033 TATTGTATAAAATCACCTCCAGG - Intronic
937761341 2:125606656-125606678 TATTGTATAAAATCACCTTCAGG - Intergenic
940392278 2:153146252-153146274 TGTTCTGGGAAATCACCTACAGG - Intergenic
940780405 2:157927272-157927294 TGTTGTATAAAATTACCTTCAGG - Intronic
941033813 2:160544086-160544108 TGTTGAGCAAAATTAAATACTGG - Intergenic
941482593 2:166035669-166035691 AGTTGGGCAAAATCATCTAAAGG + Intronic
942496242 2:176542676-176542698 TGTTGGGAAAAATCATCTCCAGG - Intergenic
944554124 2:200870959-200870981 TATTGTGTAAAATTACCTTCAGG - Exonic
945147093 2:206749710-206749732 TGTTGTATAAAATTACCTTCAGG - Intronic
947362579 2:229361495-229361517 TGTTGTGCAAAAGCAGCCAGAGG - Intronic
1173174000 20:40750604-40750626 ACTTGTGCAAAATCGCCTCCTGG - Intergenic
1173795900 20:45859598-45859620 TGCTGTGCAGAAGGACCTACAGG + Intronic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1176902153 21:14455287-14455309 CGTCGTGCAAAATCAGCTCCAGG + Intergenic
1178553260 21:33560670-33560692 TGTTGTGCAAAATCACGCTTGGG + Intronic
1178790112 21:35692184-35692206 TCTGTTGCAAAATCACCAACTGG + Intronic
1179463532 21:41554475-41554497 TGTTGTGTAAATTCTCTTACAGG - Intergenic
950916712 3:16653352-16653374 TGTTGTATAAAATTACCTTCTGG - Intronic
951191355 3:19775272-19775294 TGTAGTGCAAAAACAGCCACAGG - Intergenic
952874077 3:37927311-37927333 TATTGTGTAAAATTACCTTCAGG + Intronic
956423876 3:69112840-69112862 TGTGGATCAAAATCACCTAAAGG - Intronic
959932245 3:111997592-111997614 TATTGAGAAAAATCTCCTACCGG - Intergenic
960999244 3:123361817-123361839 TGTTGTATAAAATTACCTTCAGG - Intronic
961576725 3:127842917-127842939 TATTGTATAAAATCACCTTCAGG + Intergenic
961580800 3:127880434-127880456 TGCTGTGCTAAATAACTTACTGG - Intergenic
961735511 3:129000031-129000053 TGTTGTGCATAATCAGCTTGTGG + Intronic
963311832 3:143718246-143718268 GGATGTGCAAACTCACCTACTGG + Intronic
965023557 3:163267396-163267418 TTTTGTCTAAATTCACCTACTGG - Intergenic
966795211 3:183706996-183707018 TGTTGTATAAAATTACCTTCAGG + Intronic
970151632 4:13096438-13096460 TATTGTGCAAATTCATCTATTGG - Intergenic
970818409 4:20185461-20185483 TGTTGTATAAAATCACCTTCAGG + Intergenic
971304571 4:25468412-25468434 TATTGTACAAAATGACCTTCAGG - Intergenic
973712137 4:53640791-53640813 TTTTGTGAAAAATCAGTTACTGG - Intronic
975270868 4:72431550-72431572 TATTGTACAAAATTACCTTCAGG + Intronic
979022646 4:115523104-115523126 TAATGTGCAAAATAACCAACTGG - Intergenic
979113271 4:116786640-116786662 TGTTGGTCAAAATCTCCTGCTGG - Intergenic
979738633 4:124121395-124121417 TGATGTGCAAAAACAATTACAGG - Intergenic
980734130 4:136861893-136861915 TGTTGTGCAAACAAAACTACAGG + Intergenic
984787306 4:183580112-183580134 TGTTCTGCAAAAGCAGCCACAGG - Intergenic
985342564 4:188970903-188970925 TGCTGGGCAAAGTCACCTAACGG + Intergenic
989785459 5:45322608-45322630 TATTGTGTAAAATTACCTTCAGG - Intronic
990784207 5:59401093-59401115 TATTGTGTAAAATTACCTTCAGG + Intronic
993216191 5:85025350-85025372 TTTTTTCCAAAATCAGCTACTGG + Intergenic
993216598 5:85031622-85031644 TATTGTACAAAATTACCTTCAGG - Intergenic
993216867 5:85035817-85035839 TAATGTGTAAAATCACCTTCAGG - Intergenic
998637789 5:143975481-143975503 TATTGTACAAAATTACCTTCAGG + Intergenic
1000738222 5:164932315-164932337 TCATGTGCAAAAACACCTATAGG - Intergenic
1001240567 5:170066799-170066821 TGTAGGGCAAAAGCACCTACAGG - Intronic
1001669934 5:173465404-173465426 TCTTGCACAAAATCACATACTGG - Intergenic
1001736852 5:174012133-174012155 TATAGTGCAAAATCACATCCAGG - Intergenic
1002903026 6:1425660-1425682 TATTGTGTAAAATTACCTTCAGG + Intergenic
1002989007 6:2220634-2220656 TGTTGTATAAAATTACCTTCGGG + Intronic
1003906373 6:10703631-10703653 TATTGTGTAAAATTACCTTCCGG + Intronic
1003967406 6:11266225-11266247 AGGGGTGCAAAATCACCCACAGG - Intronic
1011992449 6:93539781-93539803 TGTTGTGCAAAAACACATATAGG + Intergenic
1015130770 6:129806566-129806588 TGTTTTGCATGATCACATACTGG + Intergenic
1017034280 6:150252962-150252984 TGCTGTGCAAAATCAGCTTTTGG + Intergenic
1027369225 7:77490876-77490898 TATTGTGTAAAATTACCTTCAGG + Intergenic
1028937014 7:96476621-96476643 TATTGTACAAAATTACCTTCCGG + Intergenic
1039372182 8:36996128-36996150 TTATGTGCAAAATCATATACTGG + Intergenic
1039804625 8:40987564-40987586 TGGTGGGAGAAATCACCTACAGG - Intergenic
1040892818 8:52335563-52335585 TATTGTGTAAGATCACCTTCAGG - Intronic
1041444924 8:57940542-57940564 TGTGGTGCAAAACCAGCCACAGG - Intergenic
1041773795 8:61501762-61501784 TATTTTGCAAACTCATCTACTGG + Exonic
1042559536 8:70062768-70062790 TATTGTGTAAAATTACCTTCAGG - Intronic
1044195372 8:89370799-89370821 TGTTGTATAAAATTACCTTCAGG - Intergenic
1047207453 8:122814372-122814394 TGTTGTGAAAAAGCACATATTGG + Intronic
1047289231 8:123514671-123514693 AGTTCTGCAGAATCACCTCCCGG + Intronic
1047423305 8:124725011-124725033 TGTTGTGCAAAATCACCTACTGG - Intronic
1047440268 8:124871578-124871600 CATTGTGCAAAATTACCTCCAGG - Intergenic
1047467133 8:125127874-125127896 TGTTGTATAAAATTACCTTCAGG - Intronic
1051784569 9:20728362-20728384 TATTGTACAAAATTACCTTCAGG - Intronic
1055523481 9:77106505-77106527 TATTGTACAAAATTACCTTCAGG - Intergenic
1057454805 9:95198548-95198570 CGTTTTGGAAAATCACCTCCTGG + Intronic
1057926648 9:99158316-99158338 TGCTGTGAATATTCACCTACAGG - Intergenic
1057956297 9:99410819-99410841 GTTTGTGCAATATCACCTCCTGG - Intergenic
1186339996 X:8634519-8634541 TGTAGTGCAAAAGCAGCCACAGG - Intronic
1186352515 X:8754805-8754827 AGTTGTGCAAAATTACCCCCCGG - Intergenic
1188434270 X:30142610-30142632 TTTTGTGCTAAATCATCTAAAGG - Intergenic
1194093638 X:89607927-89607949 TGTTATTCAAAATCTCCTAGTGG + Intergenic
1194462512 X:94189860-94189882 CGTTGTGTAAAATCACCTTCTGG + Intergenic
1194610869 X:96042288-96042310 GGTTGTGGAAAATGACCAACTGG - Intergenic
1195200733 X:102547749-102547771 TATTTTGCAAATGCACCTACTGG - Intergenic
1198757436 X:139996153-139996175 TGTTGTGCCACACCACCCACGGG + Intergenic
1199084935 X:143617481-143617503 TGTTGTCCAAAATAAACTAGGGG - Intergenic
1199268284 X:145852935-145852957 TGTTGTAAAAAATCACTTCCTGG - Intergenic
1200446268 Y:3264058-3264080 TGTTATTCAAAATCCCCTAGTGG + Intergenic
1200769530 Y:7110720-7110742 TGTAGTGCAAAAGCAGCCACAGG + Intergenic
1200866296 Y:8047283-8047305 TGTTGTCCAGGATCACCTTCTGG + Intergenic