ID: 1047423563

View in Genome Browser
Species Human (GRCh38)
Location 8:124727075-124727097
Sequence GCGCGCGCGCGCGTGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 1, 2: 21, 3: 91, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047423563 Original CRISPR GCGCGCGCGCGCGTGGGGGC GGG (reversed) Intronic
900109635 1:1000081-1000103 GCGCGCGCGGGCCTGGAGCCGGG - Exonic
900113727 1:1020057-1020079 GCGGGCGGGCGGGGGGGGGCGGG - Intergenic
900155277 1:1201319-1201341 GGGTTCTCGCGCGTGGGGGCGGG - Intergenic
900162825 1:1232416-1232438 GCGCGGGCGCGGGGGGAGGCGGG - Exonic
900162827 1:1232420-1232442 GCGCGCGCGGGCGCGGGGGGAGG - Exonic
900190086 1:1349526-1349548 GCGGGCCCGCGCGCGGGGGCGGG - Intergenic
900345365 1:2207958-2207980 GTGCGCGCGCGCATGCGTGCAGG + Intronic
900427477 1:2587118-2587140 GAGCACGCGTGCGTGGTGGCCGG + Exonic
901019106 1:6246944-6246966 GGGCGGGCGCGCGGGGGGACAGG + Intergenic
901061681 1:6474649-6474671 GGGCGGGGGCTCGTGGGGGCGGG - Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902451434 1:16499166-16499188 GTGCGCGCGTGCGCGGGGGCTGG - Intergenic
902499137 1:16896680-16896702 GCGCGAGGGCACCTGGGGGCCGG - Intronic
902501448 1:16914152-16914174 GCGCGCGCGTGCGCGGGGGCGGG + Intronic
902501461 1:16914196-16914218 GAGGCCGCGCGCCTGGGGGCGGG + Intronic
902813419 1:18902412-18902434 CCGAGCGCGCGCCTGGGGCCCGG - Intronic
903043948 1:20552434-20552456 GCGCGAGCCTGCGTGGGGGGAGG + Exonic
903389480 1:22953857-22953879 GTGCGCGCGCGCCTGGCCGCGGG - Exonic
903596991 1:24502745-24502767 GGGCGGGGGCGCGCGGGGGCCGG - Intronic
903879826 1:26500973-26500995 GCGCGCGCACGTGCCGGGGCGGG + Intergenic
905124612 1:35708038-35708060 GCGGGGCGGCGCGTGGGGGCGGG + Intergenic
906144208 1:43550360-43550382 GGGCGAGTGCGCCTGGGGGCGGG - Intronic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
906204337 1:43979183-43979205 GCGCGCGCGGGCGCGCGGGCCGG + Intronic
906521048 1:46467041-46467063 GCGCGCGTGCGCCCGTGGGCTGG - Intergenic
906678535 1:47709805-47709827 GCGCGCCCGCGTGTGTGGTCGGG - Intergenic
907223870 1:52927251-52927273 GAGTGCGCGTGCGTAGGGGCAGG - Exonic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
909622375 1:77683047-77683069 GTGCGCGCGCACGTGTGCGCGGG - Intronic
910288200 1:85577104-85577126 GGGCGCGCGGGCGGGGTGGCCGG + Intronic
910694213 1:89995016-89995038 GCGGGCCCTCGCGTGGGGGGCGG - Intergenic
910760933 1:90730439-90730461 GCGTGCGCGCGCCTGGGTGTGGG - Intergenic
912416238 1:109509766-109509788 GCGCGTGCGCGCGGCGGGGGCGG + Intergenic
912514670 1:110210416-110210438 GCTCGCGCGCGGCAGGGGGCGGG - Intergenic
912717083 1:111990239-111990261 GCGCGCGCGTGAGCGGGGGGTGG + Intergenic
913378729 1:118185335-118185357 GCGCGCGGCAGCTTGGGGGCGGG + Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
914869185 1:151459017-151459039 GTACGCGCGGGGGTGGGGGCGGG - Intronic
915722154 1:157993527-157993549 GCGCGCGCGTGTGTGTGTGCAGG + Intronic
917141633 1:171841457-171841479 GCGCGCCTGCGCGGGCGGGCAGG - Intergenic
917974790 1:180231547-180231569 GCGCGCGCGCGCGCGACGACTGG - Intronic
919916982 1:202144809-202144831 GCGCGCGCTCGGGTGCGAGCAGG - Intergenic
920705056 1:208244479-208244501 GCGCGGGCGGGGGAGGGGGCAGG - Intergenic
920912510 1:210232460-210232482 GCCCGAGAGCGCGTGGGGTCTGG + Intergenic
920922641 1:210311135-210311157 GTGCGCGCGCACGTGGCGGGGGG - Intergenic
921189874 1:212699785-212699807 GCGCGCGGGCGGGGCGGGGCGGG - Exonic
922196475 1:223364194-223364216 GAGCGCGCGGGCGGGGGAGCTGG - Intronic
922648719 1:227318507-227318529 GCGCGCGCGTGTGCCGGGGCCGG - Intergenic
922917542 1:229271051-229271073 GCGCGTGCGCACGGGGAGGCCGG - Intronic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
922958556 1:229625813-229625835 GCGCGCGCGCGGGCGGGCGGGGG - Intronic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923055899 1:230425933-230425955 GCGGGCGCGCGGGCGGCGGCCGG - Intergenic
923400760 1:233614037-233614059 GGGCGGGCGCGCGGGGGAGCGGG + Exonic
923490474 1:234479181-234479203 GCGCACGCGCACGTAGGGGCCGG - Intergenic
923506591 1:234610241-234610263 GAGCGCGCGCGCGGGAGGGCGGG - Intergenic
923506790 1:234611157-234611179 GCGAGGGCGCGAGTGGGGGGGGG + Intergenic
923783232 1:237043301-237043323 GCGCGCGCGCGGGTGGTGGTGGG + Intronic
924199052 1:241640500-241640522 GGACGCGCCCGCGGGGGGGCGGG - Intronic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1062874158 10:931730-931752 GCGCGGGTCCGCGCGGGGGCGGG - Intergenic
1063115083 10:3067401-3067423 GCGCGGGCGCGGCTAGGGGCAGG - Intronic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1064059973 10:12129479-12129501 GGGCTGGCGCGCCTGGGGGCAGG - Intergenic
1065025061 10:21534011-21534033 GGGGGCGCGCACGCGGGGGCGGG - Intergenic
1065099093 10:22316271-22316293 CCGCGCGCGGGCGCGGAGGCGGG + Exonic
1065099906 10:22321894-22321916 GGGCGCGCGCTCGCGGGCGCGGG - Intronic
1065214697 10:23438876-23438898 GCGCGCGAGCGCGCGCGGGCGGG - Intergenic
1066022876 10:31319942-31319964 GCGCGCGTGTGCGCGGGCGCCGG + Intronic
1066080803 10:31928843-31928865 GAGCGCGCCGGCGCGGGGGCGGG + Intronic
1067227404 10:44385007-44385029 GCGCGGGCGGGCGGGCGGGCGGG + Exonic
1067474378 10:46556461-46556483 CCGCGCGCTCCCGTTGGGGCGGG - Intergenic
1067650712 10:48152943-48152965 GTGTGCGCGCGCGTGTGGGAAGG - Intergenic
1069738521 10:70672902-70672924 GCGCGGGGGCCCGTGGGGTCCGG + Intronic
1069849653 10:71396795-71396817 GCGGGCGGGCGGGCGGGGGCCGG + Intergenic
1070112114 10:73496030-73496052 GCGCGTGCGGGGGTGGGGGCGGG + Intergenic
1070257770 10:74826039-74826061 GCGGGCGGGCGCGCGCGGGCGGG - Intronic
1070942157 10:80357216-80357238 GCGGGCGCGCTCCAGGGGGCGGG + Intronic
1071676367 10:87659682-87659704 GCGCGCCCGCGAGTAGGGGCCGG + Intronic
1071997566 10:91163004-91163026 GCGCGCGCGCGTGGGGCGGTAGG - Intronic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1073292264 10:102419157-102419179 GGCCGCGTGCTCGTGGGGGCGGG - Intronic
1073577827 10:104640537-104640559 GCGTGCGCGTGCGTGCGCGCAGG - Intergenic
1074088628 10:110226943-110226965 GGGAGCGCGCGCGTGAGGGGAGG + Intronic
1074618379 10:115093132-115093154 GCGCGCGCGAGGGCGGGGGGCGG + Intergenic
1077048050 11:554923-554945 GCGCGGGCGGGCGCCGGGGCTGG - Exonic
1077124337 11:925813-925835 GCGTGCGTGCGCGTGCGTGCTGG + Intronic
1077201508 11:1309691-1309713 GCGCGCGTGCGCGCGAGAGCCGG - Intergenic
1077235604 11:1480702-1480724 GTGCGCGGGGGCCTGGGGGCGGG - Intronic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1078066259 11:8081258-8081280 TCGTGCGCGCGCGTGGAGGCGGG - Intronic
1078180089 11:9004064-9004086 GCGCGCGCGGGGGGCGGGGCCGG + Intergenic
1078266282 11:9758299-9758321 CCGCGCGCCCGGGTCGGGGCTGG - Intergenic
1078316086 11:10294252-10294274 GAGCCAGCGCGGGTGGGGGCGGG - Intergenic
1079296826 11:19241674-19241696 GGGCGAGCGGGCGTGGGGGAGGG - Intergenic
1079798162 11:24833695-24833717 GTGTGCGCGCGCGCGGTGGCAGG - Intronic
1081528277 11:43942076-43942098 GCGCGCGCGCGCCTGCGGAGGGG + Intronic
1081870460 11:46380715-46380737 GCGGCCGCGCTCGTCGGGGCCGG + Intergenic
1083227515 11:61294425-61294447 GCGTGTGCGCGCGTGGGGGTGGG - Intronic
1083562219 11:63681816-63681838 GCGAGCGGGAGCCTGGGGGCTGG + Intronic
1083933379 11:65857923-65857945 GCGTGCGCGCCCGTGGGCGCCGG - Intronic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1085485646 11:76860880-76860902 GCGCGAGCGAGCGCGCGGGCTGG + Exonic
1085666289 11:78417870-78417892 GCGGGCGCGCGCGAGGCTGCCGG - Intronic
1088566743 11:111180600-111180622 GCGCGCACGCGTGTGGTGGGGGG - Intergenic
1088606845 11:111540935-111540957 GCGCGCGCTGGGGCGGGGGCTGG + Intronic
1089180657 11:116580942-116580964 GCGGCCGGGCGCGTGAGGGCTGG - Intergenic
1089397598 11:118146055-118146077 GAGTGCACGCGCGCGGGGGCGGG + Intronic
1089713671 11:120336325-120336347 GCGGGCGCGCGCGCGGGTTCCGG - Intergenic
1090155812 11:124437670-124437692 GCGCGCGCGTGCGTGCGTGCTGG + Intergenic
1090224605 11:125062708-125062730 TGGCGGGAGCGCGTGGGGGCCGG + Intergenic
1090699332 11:129279692-129279714 GCGCGCGCGGCCGAGGGGGCGGG + Intergenic
1091555210 12:1567870-1567892 GCGCGCGTGTGCGTGTGGGTGGG - Intronic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1091740776 12:2959279-2959301 GCGCGGGCGGGCGAGGGGCCGGG - Intergenic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1093547842 12:20369211-20369233 GCGCGCGCGCGCGTGGGTCGGGG + Intergenic
1093547844 12:20369215-20369237 GCGCGCGCGTGGGTCGGGGCGGG + Intergenic
1094199276 12:27780255-27780277 ACCGGCGCGCGCGTAGGGGCTGG + Exonic
1094218509 12:27970347-27970369 GCGGGCGGGCGCGCGGGGGGCGG + Intronic
1096101294 12:48971828-48971850 GCGCGCGCGCGCTGGGAGGAGGG - Intergenic
1096101296 12:48971832-48971854 GCGCGCGCGCGCGCGCTGGGAGG - Intergenic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1096254956 12:50057347-50057369 GCGCGCGCGTGTGTGCGCGCAGG - Intergenic
1096495462 12:52037170-52037192 GCGGCCGCGGGCGCGGGGGCGGG + Intronic
1096783758 12:54005626-54005648 GAGCGCGCGCGCGAGAGGGATGG + Intronic
1096994614 12:55830808-55830830 GCGCGCGTGCGCGCGGTGGGGGG - Intronic
1097895863 12:64824581-64824603 GCGAGCGAGCGCGTGGGAGACGG - Exonic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1101680009 12:106955784-106955806 GCGCGCGTGCGCGTCGGAACTGG + Exonic
1102084391 12:110124277-110124299 GCGCGCACGAGCTGGGGGGCGGG - Intergenic
1104939846 12:132389988-132390010 GCGGGGGCGGGGGTGGGGGCAGG - Intergenic
1107654058 13:42574149-42574171 GGGCGCGCGGGCGAGCGGGCAGG - Exonic
1108541951 13:51453249-51453271 GTGCGCGCGAGCGGGCGGGCGGG + Intronic
1111183990 13:84705235-84705257 GCGCGCGCGCGCGTGCGTGTTGG + Intergenic
1112504571 13:99968440-99968462 ACGCGCGCGTGCGTGGGGTCGGG - Intronic
1112507039 13:99981601-99981623 GTGCGCGCGCGGGTGCGCGCAGG + Intergenic
1112509430 13:99997070-99997092 GCGCGCGCGCCCCTGGGCGCAGG + Intergenic
1112560250 13:100506371-100506393 TCGCGGGCGGGGGTGGGGGCGGG + Intronic
1113517512 13:110914897-110914919 GCGGGCGCGGGCGTAGAGGCGGG - Exonic
1113655607 13:112066661-112066683 GCGCGCGCGCGCGGCGGCGGCGG - Intergenic
1113737643 13:112689919-112689941 GCGAGCGCGGGTGTGGGCGCGGG + Intergenic
1113841540 13:113364136-113364158 GACCGCGGGCGCGTGGGGGCGGG + Exonic
1114318369 14:21526431-21526453 GCTAGCGGGGGCGTGGGGGCGGG + Intronic
1114516059 14:23301254-23301276 GGGCGTGGGGGCGTGGGGGCGGG - Intronic
1115545469 14:34462063-34462085 CCGGCCGCGCGCGCGGGGGCCGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118323160 14:64765046-64765068 GCGCGCGCGCGGGTGGTGGATGG + Intronic
1118776850 14:68978828-68978850 GGGCGCGCACGGGAGGGGGCGGG - Intronic
1120881057 14:89416116-89416138 GCGCGCGCGCGCGTGCTGGGTGG - Intronic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121127670 14:91418144-91418166 GCGCGCGTGCGCGTGCAGCCGGG + Intergenic
1121183575 14:91947700-91947722 GCGGGCGCGCGCAGGGGTGCGGG + Exonic
1121439333 14:93939032-93939054 ACGCGCGCGCGCATGGGAGGCGG - Intronic
1121595342 14:95157664-95157686 GCGGGCGCGCGCGCGGAGGCCGG + Intronic
1121617022 14:95320002-95320024 GCGAGCGAGCGCGGGGCGGCGGG + Intergenic
1122130857 14:99604040-99604062 GCGCGCGGGCGGGGGGCGGCCGG + Intergenic
1122162180 14:99793003-99793025 GAGAGCGGGCGCGTGGGGCCCGG - Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122275118 14:100587196-100587218 GCGGGCGCGGGCGCGGAGGCGGG - Intronic
1122905717 14:104800656-104800678 GCGCGCGCGCGAGCGGCGACCGG + Intronic
1122993336 14:105249107-105249129 GCGTGGGCGCGCGCGGGCGCGGG - Intronic
1123004449 14:105314675-105314697 CCGGGCGCGCGCGGGGCGGCCGG + Exonic
1124109529 15:26773152-26773174 GCGCGCGCGGGCGCGGGGCGGGG + Intronic
1124142291 15:27088255-27088277 GCGGGGGCGGGCGCGGGGGCGGG + Intronic
1124922221 15:34038608-34038630 GCGGGGGCGCGCCTGGTGGCGGG - Intronic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1126766478 15:52016049-52016071 GCGCGCGCGCGCGCGCGCGATGG - Intronic
1127415136 15:58749929-58749951 GCGCGCATGCGCGCGGGGGACGG + Exonic
1127433423 15:58933754-58933776 CCGCGCGTGCGCGTTGGCGCAGG + Intronic
1127931642 15:63600982-63601004 GCGCGCGCGGGCGCGGGGGCTGG - Intronic
1128455633 15:67829871-67829893 CCGCGAGCGCGCGTGGCCGCCGG - Intronic
1128791136 15:70434705-70434727 GCGCGCGCGCGGGTGGAGCGGGG - Intergenic
1128791138 15:70434707-70434729 GCGCGCGCGCGCGGGTGGAGCGG - Intergenic
1129612330 15:77070815-77070837 GCGGAGGCGCCCGTGGGGGCCGG - Intronic
1130224410 15:82046309-82046331 GCGAGCGCGGGGGTGGGGGGTGG - Intergenic
1130247199 15:82262705-82262727 ACGCCCGCGCGCCAGGGGGCGGG + Exonic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1131144265 15:90001485-90001507 CGGCGGGCGCGCGTGGAGGCGGG + Exonic
1132055545 15:98648487-98648509 GCGAGCGGGCGCGTGTGCGCGGG + Intergenic
1132111709 15:99106193-99106215 GCGGGCGAGCGCGGGGCGGCAGG + Intronic
1132527715 16:425890-425912 GCGGGCGCGCGCGGGGCGCCCGG - Exonic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1132572150 16:648895-648917 GCGGGCGCCCGCGGAGGGGCTGG - Intronic
1132580824 16:683960-683982 TCGCGCGCACGCGTGGGGCTGGG - Intronic
1132591464 16:728091-728113 GCGGGCGGGCGGGCGGGGGCCGG - Intronic
1132683270 16:1152531-1152553 GCCCGCGCGCGCGTGTGTGATGG - Intergenic
1132719651 16:1309485-1309507 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1132885118 16:2179095-2179117 GCGCGGGCGCGCCGGGGGACGGG + Exonic
1132934910 16:2475260-2475282 GGGGGCGGGAGCGTGGGGGCCGG + Intronic
1133212806 16:4272586-4272608 GCGCGCCCGCCCGGGCGGGCTGG + Intronic
1133340666 16:5033677-5033699 GCGCGCGCGCGCGCGTGGATAGG + Exonic
1133924666 16:10182913-10182935 GAGCGCGCTCGCGTGTGGCCGGG + Intergenic
1134121252 16:11586583-11586605 GCGCTCGTTCGGGTGGGGGCCGG + Intronic
1134441506 16:14302050-14302072 GCGCCCGCCCGGGTGGGGGTGGG - Intergenic
1136399871 16:30011441-30011463 GCGCGCGCGGGCGGGGGCGGGGG - Intronic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136540010 16:30923818-30923840 GCGCGCGGGCTGGGGGGGGCGGG + Intronic
1137531762 16:49282407-49282429 GCGTGCGCGCGCGGCGGGGCGGG + Intergenic
1137853287 16:51767780-51767802 GGACGCGCGCGCGTGTGGGAGGG + Intergenic
1138229077 16:55324628-55324650 GTGCGCGCGCGCGCACGGGCTGG + Exonic
1138327992 16:56191420-56191442 GCGCGCGCGCGCCTGGGCCCGGG - Intronic
1138539852 16:57681374-57681396 GTGCGCGCGTGCGTGCGCGCAGG + Intronic
1138956860 16:61981682-61981704 GCGCGCGCGCGCGTGCGCTTGGG + Intronic
1139534483 16:67562912-67562934 GGGCGGGCGGGCGTGGGGGTGGG - Intronic
1139754656 16:69132624-69132646 GCGCGCGCGCACGTGGGGCCGGG + Exonic
1141831096 16:86510357-86510379 GCGGGCGGGAGCGCGGGGGCGGG + Intergenic
1141972341 16:87492450-87492472 GCGGGCGCGCGCGGGGCGCCGGG + Intergenic
1141989586 16:87602461-87602483 GCGGGGGCGCGCGGGCGGGCGGG + Intronic
1142049867 16:87951350-87951372 GGGCGCGCGGGCCCGGGGGCGGG - Intronic
1142141499 16:88474681-88474703 GAGCGGGCTGGCGTGGGGGCTGG - Intronic
1142169111 16:88611303-88611325 GCGCGAGCGCGAGCGGGAGCGGG + Exonic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143183488 17:4997900-4997922 GCGAGCGCGCGCGGAGGGGCGGG - Intergenic
1143247798 17:5500779-5500801 GCGCGCGGGCGGGAGGGCGCAGG - Intronic
1144847047 17:18225560-18225582 GGGCGCGGGCGCGCGGGGCCGGG - Intergenic
1145197641 17:20908662-20908684 GCGCGCCTGCGCGTGGGGGGGGG - Intergenic
1145214792 17:21043181-21043203 GGGCGCGCGAGTGTGGGGGAAGG - Intronic
1145937980 17:28726275-28726297 GGGCGCGGGCGGCTGGGGGCGGG - Intronic
1146439045 17:32877289-32877311 GCGCACGCGCGGGTGGGCGGCGG + Intergenic
1147168673 17:38605953-38605975 GCGCGCGCGCGGGCCGGCGCGGG + Intergenic
1147286002 17:39402532-39402554 GGGCGCGCGTCCGTGGGGGTGGG + Intergenic
1147636453 17:41967182-41967204 GCGCGGGCCTGCGTGGGGTCGGG - Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1147990019 17:44326828-44326850 GCGGGCGGGCGGGTGGAGGCGGG + Intergenic
1148284092 17:46372782-46372804 GGGCGCGCGCGCGGCGGGGGCGG + Intergenic
1148306313 17:46590703-46590725 GGGCGCGCGCGCGGCGGGGGCGG + Exonic
1148818258 17:50346071-50346093 GCGAGCGCGCGCACGGGCGCGGG - Exonic
1149454991 17:56780530-56780552 GCGCGTGCTTGCGTTGGGGCGGG - Intergenic
1149994770 17:61400598-61400620 GCGCGGGCGGGCGGGCGGGCTGG + Intronic
1150643394 17:66964408-66964430 GCGCGCGCGGGCGCGGGGAGGGG + Intergenic
1150830343 17:68512778-68512800 GCGAGCGCGAGCGGGGCGGCTGG - Intronic
1151058703 17:71064982-71065004 GCGCGCGCGCGCCTGTGTGTAGG - Intergenic
1151296904 17:73192823-73192845 GCGGGCGCGGGCGCGGGGGCGGG - Intronic
1151296916 17:73192847-73192869 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296922 17:73192861-73192883 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296928 17:73192875-73192897 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296934 17:73192889-73192911 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296940 17:73192903-73192925 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296946 17:73192917-73192939 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296952 17:73192931-73192953 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151708401 17:75785000-75785022 GCGTGCGCGCGCGGCGGGGGGGG - Intronic
1152377738 17:79927459-79927481 GCGGGCTCCCGGGTGGGGGCGGG + Intergenic
1152627483 17:81394180-81394202 GCGGGAGCGGGAGTGGGGGCGGG + Intergenic
1152689658 17:81712263-81712285 GCGCGCGCGCGCCCCGGGGGCGG - Intronic
1152708932 17:81860584-81860606 GCGCGCGCGGGCGGGGGGGCAGG - Exonic
1153006300 18:500876-500898 GAGCCCGCGCGAGTGGGGCCAGG - Intergenic
1153457515 18:5296220-5296242 GCGCGTGCGCGCGCGTGCGCAGG - Intronic
1154326567 18:13395568-13395590 GCGGGAGCTGGCGTGGGGGCGGG + Intronic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1157279026 18:46333938-46333960 GCGGGCGCGCGGGTGGCGGAGGG - Intronic
1157279101 18:46334187-46334209 GCGCGGGCGCGGGCGGCGGCGGG - Intronic
1157384229 18:47248078-47248100 GTGGGCGCGGGCGCGGGGGCGGG - Intronic
1157464257 18:47930675-47930697 GCGGGCGCGCGCCTGAGGGGAGG - Intronic
1160164297 18:76496150-76496172 GAGGGCGGGCGCGCGGGGGCGGG + Intronic
1160500712 18:79400125-79400147 TCGCGCGCGCGCGAGGGGGCGGG + Intronic
1160500714 18:79400127-79400149 GCGCGCGCGCGAGGGGGCGGGGG + Intronic
1160500716 18:79400131-79400153 GCGCGCGAGGGGGCGGGGGCGGG + Intronic
1160630977 18:80246617-80246639 GGGGGCGCGCCCGTGGGGGTGGG + Intronic
1160668523 19:344722-344744 GGGCGCGGACGCGCGGGGGCGGG + Intronic
1160810744 19:1012017-1012039 GCGAGGGCGCGGGTGGGGGCGGG - Intronic
1160824045 19:1071244-1071266 GACCGCGAGCGCGTGGGGCCTGG - Intronic
1160902961 19:1438334-1438356 GCGCGCACGGCCGAGGGGGCGGG + Intergenic
1160937817 19:1605482-1605504 GCGCACGCGCGCGGGGAGGGCGG + Exonic
1161015001 19:1979101-1979123 GCGCGCGCGCGGCGGGGGGCGGG + Intronic
1161257990 19:3320398-3320420 GCGGGCGCGGGCCAGGGGGCTGG - Intergenic
1161401598 19:4067972-4067994 GCGACCGCGCGCCTGGGGGGGGG + Intergenic
1161461560 19:4400573-4400595 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161461569 19:4400592-4400614 CCGGGGGCGCGCGCGGGGGCCGG - Intergenic
1161545459 19:4877845-4877867 GCGCTGGCGGGCGTGGGGGAGGG + Intergenic
1161550632 19:4910261-4910283 GCGCGCGCTCGCGGGTGGCCGGG + Intronic
1161643070 19:5436362-5436384 GCGCGCGCGCGCGTGCGGGGAGG + Intergenic
1161643072 19:5436364-5436386 GCGCGCGCGCGTGCGGGGAGGGG + Intergenic
1161802581 19:6424396-6424418 GCGCGCGCGCAGGCGGGGGAGGG - Intronic
1161802585 19:6424402-6424424 GCTCGCGCGCGCGCGCAGGCGGG - Intronic
1161802587 19:6424406-6424428 GCGCGCTCGCGCGCGCGCGCAGG - Intronic
1161849509 19:6731291-6731313 GCGCGAGCAGGCGTGGGGCCAGG + Intronic
1161977196 19:7613203-7613225 GGGCGGGGGCGGGTGGGGGCGGG + Intronic
1162461762 19:10817821-10817843 GCGCGCGCACGCGTGCGTGCCGG + Intronic
1162742688 19:12782649-12782671 GTGCGCGCGTGCGTGGGCGGTGG + Intronic
1162951313 19:14073451-14073473 GCGCGCGGGAGCGCGGGGCCAGG - Exonic
1163390765 19:17028427-17028449 GCGTGCACGCGCGCAGGGGCCGG + Intergenic
1163547241 19:17947820-17947842 GCGGGGGCGGGGGTGGGGGCGGG - Intergenic
1163598192 19:18232677-18232699 GCGCGCGCGCGCGTGAGACTGGG - Intronic
1163637035 19:18441752-18441774 GGGAGCGCGGGGGTGGGGGCAGG - Intergenic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1165850780 19:38849414-38849436 GCGGGCTGGCGTGTGGGGGCCGG - Intronic
1166084640 19:40466897-40466919 GCGCGCAAGCGCGTGGATGCGGG + Intronic
1166106677 19:40601226-40601248 GCGCGGGGGCGCGTGGGGCTGGG - Intronic
1166347766 19:42177012-42177034 GCGCGGGCGGGCGGGCGGGCAGG + Intronic
1166367386 19:42284431-42284453 CCCCGCGCGCGCCGGGGGGCGGG + Intronic
1167129153 19:47573082-47573104 GCGCGCGAGCCCCCGGGGGCGGG - Intergenic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167366631 19:49057956-49057978 GGGGGCGCGCGCGTCCGGGCCGG + Exonic
1167509833 19:49890197-49890219 GCGCGCCCTCGCGCGGCGGCGGG + Exonic
1167648517 19:50718222-50718244 GCGCTGCCGCGCGTGGGGGAGGG - Intronic
1168536090 19:57172051-57172073 GCGGGGGCGTGCGAGGGGGCGGG + Intergenic
1168536098 19:57172069-57172091 GCGGGGGCGCGCGAGGGGGCGGG + Intergenic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927692227 2:25216204-25216226 GCGCGCGCATGCGTTGGGGCGGG + Intergenic
929033714 2:37671807-37671829 CCGGGCGCGCGCGCGGGGGGGGG + Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929468619 2:42169313-42169335 CTGCGCGCGGGCGCGGGGGCGGG + Intergenic
929511545 2:42568948-42568970 TCGCGAGCCCGCGTGGGGGGAGG - Intronic
929788674 2:45009126-45009148 GAGGGCGCGCGCGGGCGGGCGGG - Exonic
929974126 2:46616051-46616073 GCGCGCGCGCGCGTGGGCGGAGG + Intronic
930730703 2:54725017-54725039 GCCCCGGCGCGCGGGGGGGCGGG + Exonic
931649372 2:64454392-64454414 GCGCGCGCGCGCCCGGGGCCCGG - Exonic
931867127 2:66425559-66425581 GCGCGCGCGCGCGCGCGTTCCGG - Intergenic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932036557 2:68252244-68252266 GAGGGGGCGCGCGTGGGGGAGGG + Exonic
932180716 2:69643750-69643772 GCGGGAGCGCGCGCGGGGGAGGG - Intronic
932429041 2:71663041-71663063 GCGCGCACGCGCGTGGTGTAGGG + Intronic
932496668 2:72148991-72149013 GTGAGCGCGCGGGTTGGGGCGGG - Intergenic
935408690 2:102736623-102736645 GTGAGTGCGAGCGTGGGGGCTGG - Intronic
937045284 2:118848017-118848039 GTGCGGGCGCGGGTGGGGGAGGG - Intergenic
937221748 2:120346072-120346094 GCGCGGGCGCGGGCGGGGGCGGG + Intergenic
938034867 2:128027626-128027648 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
938258350 2:129877754-129877776 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938258352 2:129877758-129877780 GGGCGCGCGTGTGGGGGGGCGGG + Intergenic
938258357 2:129877776-129877798 GCGGGCGCGCGTGTCGGGGGCGG + Intergenic
938258364 2:129877793-129877815 GGGCGGGCGCGCGTGTGGGGGGG + Intergenic
938258366 2:129877797-129877819 GGGCGCGCGTGTGGGGGGGCGGG + Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
941818768 2:169824907-169824929 ACGCGTGCGCGCGTGCGGCCTGG - Exonic
942448242 2:176092582-176092604 GCGCGCGGCCACGTGGGGGTAGG - Intergenic
943571715 2:189581646-189581668 AGGGACGCGCGCGTGGGGGCGGG - Intronic
945699433 2:213151796-213151818 GCGCGCGCGTGCGTGTGTGCGGG + Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
945699442 2:213151857-213151879 GCGCGCGCGCGCGGGCTGGCGGG + Intronic
948140863 2:235670841-235670863 GAGCGCGCGCGGGCGGCGGCCGG + Intronic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
1168812014 20:710393-710415 GCGCGCGCGTGTCTGGGGGCTGG - Intergenic
1169059644 20:2652422-2652444 GCGCGGGCGGGCGTGGTTGCCGG - Exonic
1169488327 20:6052071-6052093 GCGCGTGCGCTCCGGGGGGCAGG - Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1171237050 20:23535479-23535501 GCGCGCGCGCGGGTGAGTGTTGG - Intergenic
1172100574 20:32482579-32482601 GCGCGCGCCCTCGAGGCGGCCGG + Intronic
1172109520 20:32536913-32536935 GCGGGCGCGCGCCTAGAGGCTGG - Intronic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1172587212 20:36093086-36093108 GCGCGCGTGCGTGTGTGCGCCGG + Intronic
1172644601 20:36461752-36461774 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1173807467 20:45935091-45935113 GCGGGAGCGCGCGGCGGGGCGGG + Intronic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1175107767 20:56626972-56626994 GCGCGCGCGTGCCTGGGTGCCGG + Intergenic
1175841311 20:62029463-62029485 GCGCGCGCGCACGTGGGCACTGG - Intronic
1175856132 20:62122068-62122090 GCACGCGCGCGGGCGGGGCCTGG + Intergenic
1175856145 20:62122135-62122157 GAGCGCGCGTGCGCGTGGGCGGG - Intergenic
1175859795 20:62143931-62143953 GGGCGGGCGCGCGCGGGGACGGG + Intronic
1175902938 20:62367127-62367149 GCGCGGGCGCGGGAGGAGGCGGG - Exonic
1175911504 20:62407314-62407336 GGGCGCGCGGGCGCGCGGGCAGG - Intergenic
1175992495 20:62796685-62796707 CTGCGGACGCGCGTGGGGGCGGG + Intronic
1176131641 20:63498941-63498963 GCGCGCGCGGGGGCGGGTGCGGG + Intronic
1176178521 20:63739484-63739506 GCGAGCGCGCCCGTGGGGAACGG + Intronic
1176178539 20:63739524-63739546 GCGCGGGCGCGCGAGGTGGGCGG + Intronic
1176194569 20:63831293-63831315 GCGCGCGCGCGCGGGCGGCGGGG - Intergenic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176194585 20:63831335-63831357 CCGGGCGCGCGCCGGGGGGCGGG - Intergenic
1176207177 20:63895383-63895405 GGGCGGGCGCGGGTGGGGGGCGG + Intronic
1176547891 21:8209278-8209300 GGGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176550498 21:8218955-8218977 GCGCGTGCGTGCGGGGGGCCCGG + Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176566824 21:8392311-8392333 ATGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176569428 21:8401994-8402016 GCGCGCGCGTGCGGGGGGCCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176577340 21:8446225-8446247 GCGCGTGCGTGCGGGGGGCCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176952651 21:15064896-15064918 GGGCGCGCGCGGGTGGCGGGCGG + Exonic
1177281487 21:18987666-18987688 GCGCGCAGGCGAGTGGGTGCAGG - Intergenic
1178992284 21:37366400-37366422 GCGCGGGCGCGGGGCGGGGCGGG + Intronic
1179243858 21:39613135-39613157 GCGCGCGGGGGCGTGGGTGCCGG + Intronic
1179444228 21:41420290-41420312 GCGCGGGCGCGGGCGCGGGCAGG + Intronic
1179563938 21:42234804-42234826 TCGCGCGCGCAGGTGCGGGCGGG + Intronic
1179623984 21:42637935-42637957 GGGCGGGTGAGCGTGGGGGCAGG - Intergenic
1180675082 22:17581239-17581261 GCGCGCGTGAGCCTGGGGGCTGG + Intronic
1180949459 22:19714644-19714666 GCGCGCGCGGGCACGCGGGCAGG - Intronic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1181514388 22:23402721-23402743 GAGCGCGGGCGCGAGGGGGGCGG + Intergenic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1182149512 22:28018295-28018317 GTGTGCGCGCGCGGGGGGGGGGG + Intronic
1182149514 22:28018299-28018321 GCGCGCGCGGGGGGGGGGGCGGG + Intronic
1182321549 22:29481150-29481172 GCAGGCGCGCGGGTGGGGGGAGG + Intronic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1183149784 22:36028529-36028551 GCACGCACGCACGCGGGGGCGGG - Intergenic
1183683684 22:39349921-39349943 GCGCGCGCAGGGGAGGGGGCGGG + Intronic
1184101389 22:42343445-42343467 GCGCGGGCGCGGCGGGGGGCGGG - Intronic
1184153047 22:42649420-42649442 GCGGGCGCGCGGGGCGGGGCGGG + Intronic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184523111 22:45007441-45007463 GGGCGGGGGCGCGCGGGGGCGGG + Intronic
1184645250 22:45891714-45891736 GCGCGGGCGCGTGTGGGCACTGG - Intergenic
1184663869 22:45977454-45977476 GCGCACGCGGGGGTAGGGGCGGG + Intergenic
1184680781 22:46071328-46071350 GCGCGCGCGGGCGGGGCGGGCGG - Intronic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185255206 22:49827766-49827788 GCGGGCGCGGGCGCGGGAGCGGG + Intergenic
1185349398 22:50326773-50326795 GCGGGCGCGGGCGGGTGGGCAGG - Intronic
1185349401 22:50326781-50326803 GCGCGAGCGCGGGCGCGGGCGGG - Intronic
1185349403 22:50326785-50326807 GCGGGCGCGAGCGCGGGCGCGGG - Intronic
1185413484 22:50697725-50697747 GCGGGGGGGCGCGGGGGGGCGGG + Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203255395 22_KI270733v1_random:135296-135318 GCGCGTGCGTGCGGGGGGCCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
950911974 3:16604820-16604842 GAGCGCGTGGGAGTGGGGGCGGG + Intronic
951485209 3:23202977-23202999 GCGCGCGGCCGCGAGGGGGCGGG - Intergenic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
951611170 3:24494529-24494551 GCGCGCGCGGGCGGGCAGGCGGG - Intronic
951611172 3:24494533-24494555 CCGAGCGCGCGCGGGCGGGCAGG - Intronic
953925398 3:46980022-46980044 GCGCGCGGGCGCGCGCGCGCAGG + Intronic
954025673 3:47781576-47781598 GTTCGCGCGCCCGTGGGGGCCGG - Intronic
955911744 3:63864415-63864437 GCGCCCACGCGCGCTGGGGCGGG + Intergenic
956681448 3:71785252-71785274 GCGCGTGTGCGCGTGGGGCGTGG - Intergenic
960047257 3:113210811-113210833 GCGCACGCGCGCGTGTGTGTTGG - Intergenic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
961540868 3:127598477-127598499 GCGCGCTGGCGCGTGGCGGGCGG + Intronic
962367362 3:134795428-134795450 GTGCGGGCGCGCGTGGGTGTGGG - Exonic
962793954 3:138834914-138834936 GCGCGCGCGCACACGGGCGCGGG - Intronic
964437988 3:156674445-156674467 GCGCACGCGCGCGCAGGGGGCGG + Intronic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
965590556 3:170357366-170357388 CCGGGCGCGCGCCTGGGGGGAGG + Intergenic
966182225 3:177197638-177197660 GCGGGCGGGCGCGCGGGGGAGGG + Intergenic
967895890 3:194396306-194396328 GCGCACACCCGCGTGGGAGCTGG + Exonic
967903941 3:194486332-194486354 CCGGGGGCGAGCGTGGGGGCCGG - Intronic
968434455 4:577143-577165 GTGTGCGCGCGCGTGTGTGCGGG + Intergenic
968636570 4:1684108-1684130 GCGCGGGCGGTCGTGGGCGCGGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
968965121 4:3765844-3765866 GCGGGCGCGCGGGGCGGGGCGGG - Intergenic
969115498 4:4868473-4868495 GCGCGGGGGCGGGTGGGGGGGGG - Intergenic
969330325 4:6470952-6470974 GCGCGAGCGCGGGCGCGGGCGGG - Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970593188 4:17577179-17577201 GTGCGCCCGCGCATGCGGGCGGG - Exonic
970593236 4:17577391-17577413 GGGCGGGCGCGCCTTGGGGCGGG - Exonic
970967879 4:21948852-21948874 GCGGGGGCGCGCGGGGTGGCGGG + Intergenic
971195834 4:24471291-24471313 GCGCGCTCGCGTGTCTGGGCTGG - Intergenic
971196185 4:24472959-24472981 GCGAGCGCGCGCGTGTGGCTGGG + Intergenic
971196298 4:24473460-24473482 GGACACGCGCGCGGGGGGGCTGG - Intergenic
974047129 4:56907836-56907858 GCGCGCGCGGGCGTCGGAGGGGG + Intergenic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
977908461 4:102502365-102502387 GCGCGCGCGCGCACGGAGGGGGG - Intronic
978126842 4:105146191-105146213 GCGCGCGGGGGCGTGTGCGCGGG + Intronic
981061275 4:140427653-140427675 GCGCGTGCGCGTGCGGTGGCGGG + Exonic
984024119 4:174522525-174522547 GCGCGCGCGCGCGTGCAGCCCGG + Exonic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068431 4:186144941-186144963 GCGCGGGCGCGGGCGCGGGCGGG + Exonic
985996931 5:3602294-3602316 GGGCGCGCGCGAGTGGGGAAAGG + Intergenic
987303422 5:16617012-16617034 GCGCGGGCGCGCCTGGGTGTGGG + Exonic
989178893 5:38556739-38556761 GGGGGCGCGCGGGTTGGGGCGGG - Intronic
989178907 5:38556769-38556791 GCGCGCGCGGGCGCGCGGCCGGG - Intronic
990042313 5:51389577-51389599 GCGCGCGACCGCGGGCGGGCCGG + Intronic
990210780 5:53480175-53480197 GCGCGCGCGCGAGTGTGAGAGGG - Intergenic
990382563 5:55231685-55231707 ACGCACGCTCGCGTGGAGGCGGG - Exonic
992529378 5:77640367-77640389 GCGCGCGCACGTGTGTGTGCAGG - Intergenic
992550075 5:77851558-77851580 GCGCGCGCGCGCGTGTATGTGGG + Intronic
993457459 5:88142484-88142506 ACGCACGCGCGCCTGCGGGCGGG + Intergenic
993519463 5:88883240-88883262 GGGAGCGCGCGCGAGGGGGGGGG + Intronic
993905741 5:93621300-93621322 GCCCGCGCCCGCGAGGGGGCGGG - Intronic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
995735672 5:115296875-115296897 GGGCGGGCGGGTGTGGGGGCGGG + Intergenic
995787107 5:115841916-115841938 GCGCGCGGTCGCGTGCGGGAGGG + Exonic
997237157 5:132279336-132279358 GCGCGCGCGCGCGTGGGTGTCGG - Intronic
997282265 5:132656513-132656535 GCGCCCCCGCGCGTGGGAGAAGG - Intronic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
998836083 5:146203872-146203894 GCTCGCGGGGGCGTGGGGGAGGG + Intronic
999239131 5:150117521-150117543 GCGCGCGCGCGCGCGCTGCCAGG - Intronic
999328280 5:150656766-150656788 GCGAGCGCATGCGCGGGGGCGGG - Intronic
999330752 5:150672015-150672037 GCGCGCGTGCGCGTGTGTGTTGG - Intronic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1000665425 5:163989217-163989239 GTGCGCGCGCGTGTGGGGGGGGG + Intergenic
1002184201 5:177446741-177446763 GCGTGCGCGCGCGCGGCAGCCGG - Intronic
1002488762 5:179559104-179559126 GCGCGCGCGCGCCCGGGTGAGGG + Intronic
1002508665 5:179698682-179698704 GGGCGCGCGCGTCTCGGGGCGGG - Intronic
1002512643 5:179732964-179732986 GCGGGCTCGCGCGCGGCGGCGGG - Exonic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002559738 5:180072910-180072932 GCGCGCGCGCGCGTTTCGGAAGG - Intergenic
1002580881 5:180208963-180208985 GGGCGCGGGCTCGCGGGGGCTGG - Intronic
1002691371 5:181053004-181053026 GCGCGCGCGGCGGAGGGGGCGGG - Intronic
1002691381 5:181053028-181053050 GCGCGCGCGGCGGAGGGGGCGGG - Intronic
1003561993 6:7188253-7188275 GCGCGCGCGCACGTGTGTGACGG + Intronic
1003645605 6:7910872-7910894 GCGCGCCGGCGCGGGCGGGCGGG - Intronic
1004561803 6:16759967-16759989 GCGCGCGCGCGCCGGGCGGGGGG - Intronic
1004615321 6:17282612-17282634 GCGGGCGGGGGCGTGGGGGGGGG - Intronic
1004720442 6:18264208-18264230 GCGCGCGCACGCGGGGCAGCGGG - Intronic
1004767717 6:18749550-18749572 GCGCGCGCGCACGCGCGCGCAGG - Intergenic
1005964878 6:30720285-30720307 GGGCGCGCGTGCGCCGGGGCTGG - Exonic
1006121168 6:31806834-31806856 GCGAGCCCGCGCGTGGGGCGAGG + Exonic
1006125373 6:31834555-31834577 GCGCGCGCCCGCGCGCGCGCGGG + Intergenic
1006188893 6:32195881-32195903 GCGTGCCCCCGCATGGGGGCGGG - Exonic
1006271991 6:32972088-32972110 GCGCGCGCGCGCGGAGGGGGTGG + Exonic
1006337528 6:33428198-33428220 GCGCGCGTGTGCGTGGGCGCGGG + Intronic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1008160388 6:48068858-48068880 CCGACAGCGCGCGTGGGGGCGGG + Intergenic
1010703311 6:79077795-79077817 CCGCTCGCGGGCGTGGGGGAGGG - Intronic
1011603712 6:89081745-89081767 GCGCGCGGCGGGGTGGGGGCAGG + Intronic
1012276730 6:97283187-97283209 GAGCGCGGGCGCGCGGTGGCGGG - Intronic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1012872903 6:104693061-104693083 GCGCGCGCGCGCTGGGGTGGGGG + Intergenic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013836419 6:114341584-114341606 ACGCGCGCGCGCGCGCGGGATGG - Intronic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1014632352 6:123803237-123803259 GCGCGCGCGCTCGGGGGAGAAGG - Intergenic
1016340913 6:143060806-143060828 GCGCGGGCGCGGGGCGGGGCGGG - Intronic
1016982317 6:149864389-149864411 GCGGGGCCGCGCGGGGGGGCGGG - Intergenic
1017671974 6:156777720-156777742 GCGCGGGCGCGGGCGCGGGCAGG + Intergenic
1017737946 6:157381020-157381042 GGGCGCCCGCCCGAGGGGGCTGG + Intergenic
1018091132 6:160347908-160347930 GCGCGCGCGCGCCCCGGGTCCGG - Intergenic
1018329953 6:162716747-162716769 GCGCGCGCGCGCAGGCGGGTAGG - Intronic
1018329954 6:162716751-162716773 GCGTGCGCGCGCGCGCAGGCGGG - Intronic
1018400153 6:163414032-163414054 GCGCGTGCGCGCGTCGAGCCCGG - Intronic
1019329498 7:455624-455646 GCACGTGTGAGCGTGGGGGCGGG - Intergenic
1019343653 7:519714-519736 GCCCGCGCGGGCCTGAGGGCGGG + Intronic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1020066214 7:5190365-5190387 GAGGGCGCGCGCGCGAGGGCGGG - Exonic
1020418158 7:7969273-7969295 GCGCGCGAGCGTGTGGGAGCCGG - Exonic
1021716995 7:23469786-23469808 ACACCCACGCGCGTGGGGGCCGG - Intronic
1021719251 7:23490442-23490464 GCGGGCGGGCGCGGGCGGGCGGG + Intergenic
1021719253 7:23490446-23490468 GCGGGCGCGGGCGGGCGGGCGGG + Intergenic
1021969370 7:25951396-25951418 GGGCGGTGGCGCGTGGGGGCGGG + Intergenic
1021998561 7:26202367-26202389 CCGCGCTCCCGGGTGGGGGCGGG + Intronic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1023177442 7:37448129-37448151 GCGAGCGCGCTCGTGGGAGGGGG - Intronic
1023810261 7:43906360-43906382 GGCCGCGCGGGCGTGGGGGGCGG - Intronic
1023813001 7:43926739-43926761 GCGCGAGCGCGGGGCGGGGCCGG + Intronic
1023881980 7:44325832-44325854 GCGGGCGCGCGTGTGAGTGCAGG - Intronic
1024043793 7:45574378-45574400 GGGCGCGCGCGCGGGGCAGCCGG + Intronic
1025829627 7:65038211-65038233 GGCCGCGCGCCTGTGGGGGCGGG + Intergenic
1025916841 7:65873122-65873144 GCGCGCGCGGGCGCGGAGGGAGG - Intergenic
1025916868 7:65873185-65873207 GGCCGCGCGCCTGTGGGGGCGGG + Intergenic
1027198241 7:76046348-76046370 GCGCGCGCGCGCTTTTGAGCCGG + Intronic
1029465144 7:100720684-100720706 GTGCGTGCGCGGGTGGGGGTGGG - Intergenic
1029483723 7:100827219-100827241 GCGCGCGCGGGCGGCGGGCCCGG + Exonic
1029487537 7:100852693-100852715 GCGCGCGTGCTGGTGGGGGTGGG + Intronic
1029496326 7:100896993-100897015 GTGCGCGCGCGCGGCGGTGCGGG + Intergenic
1031043401 7:116862400-116862422 GTGCGCGGGCGCCTGGTGGCCGG - Intronic
1032013410 7:128360966-128360988 GCGCGCGCGCGTGCAGGGGCAGG - Intronic
1032298798 7:130668394-130668416 GCGCGCGCGGGCGCCGGGGCGGG + Intronic
1032710931 7:134459283-134459305 GCGCGGGCGAGCGTTGGGGGCGG - Intronic
1033365947 7:140672907-140672929 GCGCGGGCGCAGGCGGGGGCCGG - Intronic
1034129283 7:148699817-148699839 GCGCGCGCTCCCGTTGGGACCGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034147330 7:148884472-148884494 GTGCGCGCGCGGGCGGCGGCGGG + Intergenic
1034418801 7:150978414-150978436 TCGGGCGCGCGCGGTGGGGCGGG - Intergenic
1034446192 7:151115397-151115419 GGGTGCGCGCGCGCGGCGGCCGG - Intronic
1034649213 7:152676166-152676188 GCGCACGCGCGCGGGTGGGCGGG - Intergenic
1035045343 7:155962028-155962050 GTGTGCGTGGGCGTGGGGGCAGG + Intergenic
1035125832 7:156607419-156607441 GCTCGGGCGCGGGTGGGCGCGGG - Intergenic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1037900480 8:22685431-22685453 GCGCGCGCGCGCGCGGGGAGGGG + Intergenic
1037900482 8:22685435-22685457 GCGCGCGCGCGGGGAGGGGAGGG + Intergenic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1039595454 8:38787133-38787155 GCGCGCGCGCGCGGGGGCGGCGG - Intronic
1039608351 8:38900993-38901015 GCCCGAGCGAGCGTCGGGGCCGG + Intergenic
1039948978 8:42153152-42153174 GGGCGCGCGAGGGTCGGGGCGGG + Intronic
1040495208 8:47960137-47960159 GCGGGCGCACGCGCGGGAGCGGG - Exonic
1042235967 8:66613368-66613390 GAGCGCGCGCGGCTGAGGGCGGG + Intronic
1042578913 8:70254686-70254708 GGGCGGGCGGGGGTGGGGGCAGG + Intronic
1042962669 8:74320757-74320779 GCGGGCGCGGGCGCGGGGGTGGG + Intronic
1043471322 8:80566028-80566050 GCCCCCGCGCGCCTGGGGTCTGG - Intergenic
1045277795 8:100722526-100722548 GCGGCCGCGCACGTGGGGGGTGG - Exonic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1047961750 8:130016316-130016338 GGGCGCGCGCGCGGGCCGGCCGG + Intronic
1048484258 8:134832346-134832368 GTGCGCGCGCGCGTGGGGAAGGG + Intergenic
1048981101 8:139703726-139703748 CCGCGCGCCCGGGTGGGCGCTGG - Intergenic
1049146031 8:141001500-141001522 CTGCGCGCGGGCGTGGCGGCCGG + Intronic
1049194398 8:141307791-141307813 GCGCGCCCCGGGGTGGGGGCCGG + Intronic
1049420970 8:142516477-142516499 GTGTGCGCGCGCGTGTGTGCGGG + Intronic
1049452503 8:142669794-142669816 GCGGGCGCGCGGGGCGGGGCGGG - Intronic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1050964939 9:11788017-11788039 GTGCGCGCGCGTGTGTGTGCAGG + Intergenic
1051170263 9:14314154-14314176 GGGCGCGCGCGGGAGAGGGCCGG + Intronic
1051418810 9:16870806-16870828 GCGCGCGCGGGCGGGCGGGGAGG - Intronic
1051418812 9:16870810-16870832 GAGGGCGCGCGCGGGCGGGCGGG - Intronic
1053240127 9:36487991-36488013 GTTCGCGCCCGCGAGGGGGCCGG + Intergenic
1054835642 9:69672518-69672540 GCGCGCACGCGAGTGGGCGAGGG - Intergenic
1054842662 9:69760012-69760034 GAGCGCGCGCGCGCGCGCGCGGG + Intergenic
1056532465 9:87498764-87498786 CCCCGCGCGCGCGTGGGGCCGGG - Intronic
1057245605 9:93451880-93451902 GCGCGGGCGCGGGTGCGGGCGGG - Exonic
1057390724 9:94639679-94639701 GCGGCAGGGCGCGTGGGGGCGGG - Intronic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057596097 9:96417583-96417605 GCGCGGGCGGGCGGGCGGGCGGG - Intronic
1057619125 9:96619458-96619480 GCGCGGGCGCTCGGGGCGGCGGG + Exonic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1058687231 9:107489607-107489629 GCGCGCGCGGCCATGGGCGCGGG + Exonic
1059102501 9:111483930-111483952 GGGCGGGCGCGCGAGGGGCCCGG - Intronic
1060283371 9:122228488-122228510 GCGCGCGCGAGCGGGGGGGGGGG - Intronic
1060283373 9:122228490-122228512 GCGCGCGCGCGAGCGGGGGGGGG - Intronic
1060283375 9:122228492-122228514 GAGCGCGCGCGCGAGCGGGGGGG - Intronic
1060544761 9:124453387-124453409 GCGCGCTGGGGCGCGGGGGCTGG + Exonic
1060549372 9:124477810-124477832 CGGCGCCCGCGGGTGGGGGCGGG - Intronic
1060952322 9:127612201-127612223 CCGCCGGCGCGCGCGGGGGCGGG - Intergenic
1061128110 9:128689420-128689442 GCGCGAGCGAGCGAGGGGGAGGG + Intronic
1061275931 9:129569282-129569304 GCGCGGGCGCGGGTGTGGGAAGG + Intergenic
1061453490 9:130681578-130681600 GGGCGCGTGCGCGTGCGGGGCGG - Exonic
1061487692 9:130928672-130928694 GCTTGGGCGCCCGTGGGGGCAGG + Intronic
1061816497 9:133200347-133200369 GCCCGCGGGCGGGAGGGGGCCGG + Intergenic
1061853272 9:133428569-133428591 GCGGGGGCGGGGGTGGGGGCGGG - Intronic
1061976103 9:134068539-134068561 GAGCGCGCGCGCGGGGCGGGGGG + Intergenic
1061976105 9:134068543-134068565 GCGCGCGCGGGGCGGGGGGCGGG + Intergenic
1062022576 9:134326389-134326411 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1062306004 9:135907426-135907448 GCGGGGGCGGGCGCGGGGGCGGG + Intergenic
1062316145 9:135967812-135967834 GCGCGCGCGCGCCTGTGTGTGGG + Intergenic
1062579231 9:137222159-137222181 GCGGGCGCGGGCGTGGGGCGCGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1203471793 Un_GL000220v1:118431-118453 GCGCGCGCGTGCGGGGGGCCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1187464424 X:19515094-19515116 GCGAGGGCGAGAGTGGGGGCGGG - Exonic
1189310506 X:40014432-40014454 GCGCGCGCGCGCTCGAGTGCCGG + Intergenic
1189310602 X:40014816-40014838 GCGCGCGCGCTCGTGGAGCGGGG - Intergenic
1189325188 X:40107408-40107430 GCGCGCGCTTGGGTGGGGGCGGG - Intronic
1189325190 X:40107412-40107434 GAGCGCGCGCGCTTGGGTGGGGG - Intronic
1189325632 X:40109266-40109288 GAGCGCGCGGGGGTGGGGGTGGG - Intronic
1190862636 X:54358651-54358673 CAGTGCGCGCGCGCGGGGGCTGG + Intergenic
1195158082 X:102142476-102142498 GGGCGGGCGGGCGCGGGGGCTGG + Exonic
1195308374 X:103607913-103607935 GGGCGGGCGGGCGCGGGGGCTGG - Intronic
1195316845 X:103687501-103687523 GGGCGCGCGCGCGTGCGTGATGG + Intronic
1195316847 X:103687505-103687527 GCGCGCGCGTGCGTGATGGTGGG + Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic
1197735082 X:129844185-129844207 GCGCGCGCGTGTGTGTAGGCTGG - Intergenic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1198388021 X:136147324-136147346 GCGCGCGCGCGGGAGACGGCCGG - Intergenic
1200138512 X:153886185-153886207 GCGGGCGTGCGCGCAGGGGCGGG + Intronic
1200229438 X:154436843-154436865 GGGCGCGCGCGGGGCGGGGCGGG + Intergenic
1200233540 X:154457985-154458007 GCGCGGGCGCGCGCGGGTTCCGG + Intergenic