ID: 1047425376

View in Genome Browser
Species Human (GRCh38)
Location 8:124740683-124740705
Sequence GGTCCAGTAATGCATCTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047425376_1047425380 12 Left 1047425376 8:124740683-124740705 CCATCTAGATGCATTACTGGACC No data
Right 1047425380 8:124740718-124740740 AAGGAAGGTACATTATGTGTTGG No data
1047425376_1047425381 13 Left 1047425376 8:124740683-124740705 CCATCTAGATGCATTACTGGACC No data
Right 1047425381 8:124740719-124740741 AGGAAGGTACATTATGTGTTGGG No data
1047425376_1047425382 24 Left 1047425376 8:124740683-124740705 CCATCTAGATGCATTACTGGACC No data
Right 1047425382 8:124740730-124740752 TTATGTGTTGGGTAACCATTTGG No data
1047425376_1047425378 -3 Left 1047425376 8:124740683-124740705 CCATCTAGATGCATTACTGGACC No data
Right 1047425378 8:124740703-124740725 ACCACACATTGTGTAAAGGAAGG No data
1047425376_1047425377 -7 Left 1047425376 8:124740683-124740705 CCATCTAGATGCATTACTGGACC No data
Right 1047425377 8:124740699-124740721 CTGGACCACACATTGTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047425376 Original CRISPR GGTCCAGTAATGCATCTAGA TGG (reversed) Intergenic
No off target data available for this crispr