ID: 1047427832

View in Genome Browser
Species Human (GRCh38)
Location 8:124762824-124762846
Sequence CCTTATATCCAGAGTCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047427832_1047427835 -3 Left 1047427832 8:124762824-124762846 CCTGGTTGACTCTGGATATAAGG No data
Right 1047427835 8:124762844-124762866 AGGGCATCTGAAAAGCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047427832 Original CRISPR CCTTATATCCAGAGTCAACC AGG (reversed) Intergenic
No off target data available for this crispr