ID: 1047430210

View in Genome Browser
Species Human (GRCh38)
Location 8:124784693-124784715
Sequence TGCATCGATGTCCCTCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047430210_1047430211 -9 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430210_1047430214 15 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430214 8:124784731-124784753 TCCTTTCTGGTCCTGTGCTCAGG No data
1047430210_1047430212 2 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430212 8:124784718-124784740 TAACACTCCTGGCTCCTTTCTGG No data
1047430210_1047430217 26 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430217 8:124784742-124784764 CCTGTGCTCAGGATTCCGCAAGG No data
1047430210_1047430218 29 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430218 8:124784745-124784767 GTGCTCAGGATTCCGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047430210 Original CRISPR TGCATCGATGTCCCTCCACA TGG (reversed) Intergenic
No off target data available for this crispr