ID: 1047430211

View in Genome Browser
Species Human (GRCh38)
Location 8:124784707-124784729
Sequence ATCGATGCATGTAACACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047430205_1047430211 7 Left 1047430205 8:124784677-124784699 CCCTTGCTGTGTGTTTCCATGTG No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430203_1047430211 13 Left 1047430203 8:124784671-124784693 CCTTTCCCCTTGCTGTGTGTTTC No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430202_1047430211 16 Left 1047430202 8:124784668-124784690 CCTCCTTTCCCCTTGCTGTGTGT No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430210_1047430211 -9 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430206_1047430211 6 Left 1047430206 8:124784678-124784700 CCTTGCTGTGTGTTTCCATGTGG No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430204_1047430211 8 Left 1047430204 8:124784676-124784698 CCCCTTGCTGTGTGTTTCCATGT No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data
1047430201_1047430211 30 Left 1047430201 8:124784654-124784676 CCTCTTATGTGGAACCTCCTTTC No data
Right 1047430211 8:124784707-124784729 ATCGATGCATGTAACACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047430211 Original CRISPR ATCGATGCATGTAACACTCC TGG Intergenic
No off target data available for this crispr