ID: 1047430214

View in Genome Browser
Species Human (GRCh38)
Location 8:124784731-124784753
Sequence TCCTTTCTGGTCCTGTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047430210_1047430214 15 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430214 8:124784731-124784753 TCCTTTCTGGTCCTGTGCTCAGG No data
1047430206_1047430214 30 Left 1047430206 8:124784678-124784700 CCTTGCTGTGTGTTTCCATGTGG No data
Right 1047430214 8:124784731-124784753 TCCTTTCTGGTCCTGTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047430214 Original CRISPR TCCTTTCTGGTCCTGTGCTC AGG Intergenic
No off target data available for this crispr