ID: 1047430217

View in Genome Browser
Species Human (GRCh38)
Location 8:124784742-124784764
Sequence CCTGTGCTCAGGATTCCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047430210_1047430217 26 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430217 8:124784742-124784764 CCTGTGCTCAGGATTCCGCAAGG No data
1047430213_1047430217 -6 Left 1047430213 8:124784725-124784747 CCTGGCTCCTTTCTGGTCCTGTG No data
Right 1047430217 8:124784742-124784764 CCTGTGCTCAGGATTCCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047430217 Original CRISPR CCTGTGCTCAGGATTCCGCA AGG Intergenic
No off target data available for this crispr