ID: 1047430218

View in Genome Browser
Species Human (GRCh38)
Location 8:124784745-124784767
Sequence GTGCTCAGGATTCCGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047430215_1047430218 -10 Left 1047430215 8:124784732-124784754 CCTTTCTGGTCCTGTGCTCAGGA No data
Right 1047430218 8:124784745-124784767 GTGCTCAGGATTCCGCAAGGAGG No data
1047430210_1047430218 29 Left 1047430210 8:124784693-124784715 CCATGTGGAGGGACATCGATGCA No data
Right 1047430218 8:124784745-124784767 GTGCTCAGGATTCCGCAAGGAGG No data
1047430213_1047430218 -3 Left 1047430213 8:124784725-124784747 CCTGGCTCCTTTCTGGTCCTGTG No data
Right 1047430218 8:124784745-124784767 GTGCTCAGGATTCCGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047430218 Original CRISPR GTGCTCAGGATTCCGCAAGG AGG Intergenic
No off target data available for this crispr