ID: 1047433749

View in Genome Browser
Species Human (GRCh38)
Location 8:124817020-124817042
Sequence ATGTATCCCTTAAATGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047433747_1047433749 13 Left 1047433747 8:124816984-124817006 CCTACTAAGTAGGTAAAAATTCT No data
Right 1047433749 8:124817020-124817042 ATGTATCCCTTAAATGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047433749 Original CRISPR ATGTATCCCTTAAATGATGA GGG Intergenic
No off target data available for this crispr