ID: 1047434689

View in Genome Browser
Species Human (GRCh38)
Location 8:124826376-124826398
Sequence GTTTCAATGGGGAGAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047434689_1047434697 5 Left 1047434689 8:124826376-124826398 CCAGGCACTCTCCCCATTGAAAC No data
Right 1047434697 8:124826404-124826426 AGCTGGCATGATGAGAGGGCAGG No data
1047434689_1047434698 14 Left 1047434689 8:124826376-124826398 CCAGGCACTCTCCCCATTGAAAC No data
Right 1047434698 8:124826413-124826435 GATGAGAGGGCAGGTAAAGAAGG No data
1047434689_1047434695 1 Left 1047434689 8:124826376-124826398 CCAGGCACTCTCCCCATTGAAAC No data
Right 1047434695 8:124826400-124826422 GTCCAGCTGGCATGATGAGAGGG No data
1047434689_1047434694 0 Left 1047434689 8:124826376-124826398 CCAGGCACTCTCCCCATTGAAAC No data
Right 1047434694 8:124826399-124826421 AGTCCAGCTGGCATGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047434689 Original CRISPR GTTTCAATGGGGAGAGTGCC TGG (reversed) Intergenic
No off target data available for this crispr