ID: 1047435036

View in Genome Browser
Species Human (GRCh38)
Location 8:124829196-124829218
Sequence TCCTCTCACAGGTGACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047435036_1047435040 -8 Left 1047435036 8:124829196-124829218 CCTGGAGGTCACCTGTGAGAGGA No data
Right 1047435040 8:124829211-124829233 TGAGAGGATCAGTAGGATTTGGG No data
1047435036_1047435039 -9 Left 1047435036 8:124829196-124829218 CCTGGAGGTCACCTGTGAGAGGA No data
Right 1047435039 8:124829210-124829232 GTGAGAGGATCAGTAGGATTTGG No data
1047435036_1047435041 5 Left 1047435036 8:124829196-124829218 CCTGGAGGTCACCTGTGAGAGGA No data
Right 1047435041 8:124829224-124829246 AGGATTTGGGTATAAAAAGATGG No data
1047435036_1047435042 11 Left 1047435036 8:124829196-124829218 CCTGGAGGTCACCTGTGAGAGGA No data
Right 1047435042 8:124829230-124829252 TGGGTATAAAAAGATGGAAAAGG No data
1047435036_1047435043 12 Left 1047435036 8:124829196-124829218 CCTGGAGGTCACCTGTGAGAGGA No data
Right 1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047435036 Original CRISPR TCCTCTCACAGGTGACCTCC AGG (reversed) Intergenic
No off target data available for this crispr