ID: 1047435038

View in Genome Browser
Species Human (GRCh38)
Location 8:124829207-124829229
Sequence AATCCTACTGATCCTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047435038_1047435045 25 Left 1047435038 8:124829207-124829229 CCTGTGAGAGGATCAGTAGGATT No data
Right 1047435045 8:124829255-124829277 CCCAGCAGAAAAGCAGATCCAGG No data
1047435038_1047435047 26 Left 1047435038 8:124829207-124829229 CCTGTGAGAGGATCAGTAGGATT No data
Right 1047435047 8:124829256-124829278 CCAGCAGAAAAGCAGATCCAGGG No data
1047435038_1047435043 1 Left 1047435038 8:124829207-124829229 CCTGTGAGAGGATCAGTAGGATT No data
Right 1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG No data
1047435038_1047435041 -6 Left 1047435038 8:124829207-124829229 CCTGTGAGAGGATCAGTAGGATT No data
Right 1047435041 8:124829224-124829246 AGGATTTGGGTATAAAAAGATGG No data
1047435038_1047435042 0 Left 1047435038 8:124829207-124829229 CCTGTGAGAGGATCAGTAGGATT No data
Right 1047435042 8:124829230-124829252 TGGGTATAAAAAGATGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047435038 Original CRISPR AATCCTACTGATCCTCTCAC AGG (reversed) Intergenic
No off target data available for this crispr