ID: 1047435043

View in Genome Browser
Species Human (GRCh38)
Location 8:124829231-124829253
Sequence GGGTATAAAAAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047435038_1047435043 1 Left 1047435038 8:124829207-124829229 CCTGTGAGAGGATCAGTAGGATT No data
Right 1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG No data
1047435036_1047435043 12 Left 1047435036 8:124829196-124829218 CCTGGAGGTCACCTGTGAGAGGA No data
Right 1047435043 8:124829231-124829253 GGGTATAAAAAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047435043 Original CRISPR GGGTATAAAAAGATGGAAAA GGG Intergenic
No off target data available for this crispr