ID: 1047435131

View in Genome Browser
Species Human (GRCh38)
Location 8:124829781-124829803
Sequence ACCACCCAGAAACTAGACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047435129_1047435131 2 Left 1047435129 8:124829756-124829778 CCAGTGGGGTGGGACTTCCTTTG No data
Right 1047435131 8:124829781-124829803 ACCACCCAGAAACTAGACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047435131 Original CRISPR ACCACCCAGAAACTAGACTA AGG Intergenic
No off target data available for this crispr