ID: 1047435168

View in Genome Browser
Species Human (GRCh38)
Location 8:124830008-124830030
Sequence CTCCCTTTACAGACAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047435168_1047435175 19 Left 1047435168 8:124830008-124830030 CCACTGCCTGTCTGTAAAGGGAG No data
Right 1047435175 8:124830050-124830072 AAGATCAGCTGTTACGTAGCAGG No data
1047435168_1047435176 20 Left 1047435168 8:124830008-124830030 CCACTGCCTGTCTGTAAAGGGAG No data
Right 1047435176 8:124830051-124830073 AGATCAGCTGTTACGTAGCAGGG No data
1047435168_1047435174 -8 Left 1047435168 8:124830008-124830030 CCACTGCCTGTCTGTAAAGGGAG No data
Right 1047435174 8:124830023-124830045 AAAGGGAGGTGGTTTCAGGAGGG No data
1047435168_1047435173 -9 Left 1047435168 8:124830008-124830030 CCACTGCCTGTCTGTAAAGGGAG No data
Right 1047435173 8:124830022-124830044 TAAAGGGAGGTGGTTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047435168 Original CRISPR CTCCCTTTACAGACAGGCAG TGG (reversed) Intergenic
No off target data available for this crispr