ID: 1047437531

View in Genome Browser
Species Human (GRCh38)
Location 8:124847280-124847302
Sequence GGGAAGCTTTGGCGTGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047437528_1047437531 -7 Left 1047437528 8:124847264-124847286 CCTTTCAAGGTGCAACGGGAAGC No data
Right 1047437531 8:124847280-124847302 GGGAAGCTTTGGCGTGTGTTGGG No data
1047437524_1047437531 7 Left 1047437524 8:124847250-124847272 CCTGGGTTTGGATTCCTTTCAAG No data
Right 1047437531 8:124847280-124847302 GGGAAGCTTTGGCGTGTGTTGGG No data
1047437523_1047437531 18 Left 1047437523 8:124847239-124847261 CCTGGGAAGATCCTGGGTTTGGA No data
Right 1047437531 8:124847280-124847302 GGGAAGCTTTGGCGTGTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047437531 Original CRISPR GGGAAGCTTTGGCGTGTGTT GGG Intergenic
No off target data available for this crispr