ID: 1047438357

View in Genome Browser
Species Human (GRCh38)
Location 8:124854661-124854683
Sequence CATGTCCAAGATACTGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047438355_1047438357 20 Left 1047438355 8:124854618-124854640 CCAAGGTGGGTGTTTATTCAACA No data
Right 1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG No data
1047438352_1047438357 25 Left 1047438352 8:124854613-124854635 CCCCTCCAAGGTGGGTGTTTATT No data
Right 1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG No data
1047438354_1047438357 23 Left 1047438354 8:124854615-124854637 CCTCCAAGGTGGGTGTTTATTCA No data
Right 1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG No data
1047438353_1047438357 24 Left 1047438353 8:124854614-124854636 CCCTCCAAGGTGGGTGTTTATTC No data
Right 1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047438357 Original CRISPR CATGTCCAAGATACTGTGGT AGG Intergenic
No off target data available for this crispr