ID: 1047445307

View in Genome Browser
Species Human (GRCh38)
Location 8:124913953-124913975
Sequence GCCCCCTAGAACCTAGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047445307_1047445315 3 Left 1047445307 8:124913953-124913975 CCCCAGTCTAGGTTCTAGGGGGC No data
Right 1047445315 8:124913979-124914001 GGCTGAAGCACCCATCAGTGGGG No data
1047445307_1047445314 2 Left 1047445307 8:124913953-124913975 CCCCAGTCTAGGTTCTAGGGGGC No data
Right 1047445314 8:124913978-124914000 AGGCTGAAGCACCCATCAGTGGG No data
1047445307_1047445313 1 Left 1047445307 8:124913953-124913975 CCCCAGTCTAGGTTCTAGGGGGC No data
Right 1047445313 8:124913977-124913999 CAGGCTGAAGCACCCATCAGTGG No data
1047445307_1047445316 4 Left 1047445307 8:124913953-124913975 CCCCAGTCTAGGTTCTAGGGGGC No data
Right 1047445316 8:124913980-124914002 GCTGAAGCACCCATCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047445307 Original CRISPR GCCCCCTAGAACCTAGACTG GGG (reversed) Intergenic
No off target data available for this crispr