ID: 1047448507

View in Genome Browser
Species Human (GRCh38)
Location 8:124941446-124941468
Sequence CTTCACCTGTAAAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1106
Summary {0: 1, 1: 5, 2: 35, 3: 248, 4: 817}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1047448507_1047448510 -2 Left 1047448507 8:124941446-124941468 CCATCCTCATTTTACAGGTGAAG 0: 1
1: 5
2: 35
3: 248
4: 817
Right 1047448510 8:124941467-124941489 AGGATCTAAAACCTGAAAAGAGG 0: 1
1: 0
2: 3
3: 23
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1047448507 Original CRISPR CTTCACCTGTAAAATGAGGA TGG (reversed) Intergenic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
901266019 1:7911445-7911467 CTTCATCTGTAAAATTACGTGGG - Intergenic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901300706 1:8198227-8198249 GTGCAGCTGTAAAATGAGGATGG + Intergenic
902030983 1:13422057-13422079 GTTTCCCTGTAAAATCAGGATGG + Intergenic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903073421 1:20741653-20741675 CTTAACCTACAAAATGAGGAAGG - Intergenic
903168975 1:21540509-21540531 CCTCACCTGTAAAATGGAGCTGG + Intronic
903185137 1:21624618-21624640 CCTCTCCTGTCAAAGGAGGATGG + Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903366965 1:22811097-22811119 CTTCATTTGTAAAATGAGAGGGG + Intronic
903452696 1:23465404-23465426 CTTCATCTTTAAAATGGGAATGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903624240 1:24719912-24719934 CCTCATCTGTAAAATAACGATGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903746674 1:25591680-25591702 CTTCCCCTCTAGAATGAAGAGGG - Intergenic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904254954 1:29248980-29249002 CCTCACCTGTAAAATGAGAGTGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904449942 1:30604744-30604766 CTTCATCTGTCAAATAGGGATGG - Intergenic
904483423 1:30808018-30808040 TTTCACCTATTAAATCAGGAGGG + Intergenic
904819937 1:33235385-33235407 CTTCTCCTGGCAAATGAAGATGG - Intergenic
904914273 1:33958651-33958673 TTACAGCTGTAAAATCAGGATGG - Intronic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
904933129 1:34106393-34106415 CTTTACCTGTAATATGATGAGGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905233178 1:36528336-36528358 CCTTACCTGTAAATTGAGAATGG - Intergenic
905384825 1:37595356-37595378 TTTGACCTTTAAAATGAGAAAGG - Intronic
905405195 1:37727697-37727719 CCTCAGCTGTAAGATGAAGATGG - Intronic
905458683 1:38106559-38106581 AGTCACCTGTAAACTGGGGATGG + Intergenic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905679270 1:39855865-39855887 CTTCACCTGTCGAATCAAGAAGG + Intronic
905922640 1:41729603-41729625 CTCCTTCTGTAAAATGAGTAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906672672 1:47667940-47667962 CTTCTCATGTAAAATGAAGCTGG + Intergenic
906899749 1:49821358-49821380 CTTCATCTGTAAAATTAAGATGG + Intronic
907315877 1:53572268-53572290 CTCCATCTGTAAAATGAGAATGG + Intronic
907318635 1:53588879-53588901 CTTCTTCTGTAAAATGGGCATGG + Intronic
907430531 1:54408644-54408666 CTTCACCTGTCAAATGGCAAAGG + Intronic
907482960 1:54757369-54757391 TTTCACGTGTAAGATGAGAATGG - Exonic
907506928 1:54925938-54925960 CTTCTGCTGCAAAATGAGGGGGG - Intergenic
907684007 1:56591987-56592009 ATTCAGGTGAAAAATGAGGAAGG + Intronic
907699260 1:56767255-56767277 CTTCTCATGTAAAAAGATGAGGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908258259 1:62319663-62319685 CTGCACCTATCAAATGAGGATGG - Intergenic
908846807 1:68333023-68333045 CTTCATCTGTAAAATGACGGGGG + Intergenic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910341513 1:86193646-86193668 TGTCACCTGTAAAATAAGCAGGG + Intergenic
910487856 1:87735704-87735726 CCTCAACTATAAAATGAGGGGGG - Intergenic
910498545 1:87861776-87861798 CTTCAGGTGTAAATTGAGGAGGG + Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
910725862 1:90338100-90338122 CTTCATCTACAAAATGATGATGG + Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
911054708 1:93699973-93699995 CCTTACCTGTAAAATGGGGTGGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
911653610 1:100418073-100418095 CTTTTCCTGTAAAATGAAAATGG + Intronic
911654452 1:100427497-100427519 CCTCTCCAGAAAAATGAGGAAGG - Intronic
912627353 1:111216535-111216557 TTTTCCCTGTAAAATGGGGAAGG + Intronic
912998433 1:114555057-114555079 ACTCACCTGTAAAATCAGGTTGG + Intergenic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
913665830 1:121048152-121048174 TTTCAACTGTAATATGAGGATGG - Intergenic
914017230 1:143831428-143831450 TTTCAACTGTAATATGAGGATGG - Intergenic
914160556 1:145129570-145129592 TTTCAACTGTAATATGAGGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
914655841 1:149739968-149739990 TTTCAACTGTAATATGAGGATGG - Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916608718 1:166368671-166368693 CTTCACCTGTAACATAGAGATGG - Intergenic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
916703886 1:167326519-167326541 CTTCCCCTCTAAAATTAGTAGGG + Intronic
916744405 1:167673563-167673585 CAACATCTGTAAAATGAGGTGGG - Intronic
917087639 1:171319557-171319579 TCTCACCTGTAAAATGTGAATGG - Intronic
917217762 1:172695884-172695906 CTTCATTTGTAAAATAAGGTTGG - Intergenic
917642286 1:176994727-176994749 CTTCACCTATAAAGTGGAGATGG + Intronic
917801195 1:178572229-178572251 CTTCACCTGTAAAATGAAGGCGG - Intergenic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918118376 1:181516441-181516463 CTTCATCTGTAAAATGGGACTGG - Intronic
918220489 1:182432207-182432229 CCTCCACTATAAAATGAGGACGG - Intergenic
918286147 1:183056657-183056679 CCTCACCTGTATAATGAGCGTGG - Intronic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
919641885 1:200053413-200053435 CTTCATATGTAAAAAGAGGTAGG - Intronic
919643033 1:200064173-200064195 CTTAACTTGTAAAGTGAAGACGG - Intronic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921300178 1:213744579-213744601 CTTTATCTGTAAAATGGGGCTGG + Intergenic
921307407 1:213810817-213810839 TCTTATCTGTAAAATGAGGATGG - Intergenic
921380139 1:214516216-214516238 CTTCAACTGTGAAAAAAGGAAGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921790929 1:219289753-219289775 CTTAATTTATAAAATGAGGATGG - Intergenic
921812434 1:219530083-219530105 TCTCACTTTTAAAATGAGGAGGG - Intergenic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924614940 1:245605122-245605144 CCTCACCTGACAGATGAGGAAGG - Intronic
924740205 1:246790429-246790451 CCTCACCTGGAAAACAAGGAGGG - Intergenic
924784510 1:247183106-247183128 GTTCACTTGTGAAATGAGGCTGG - Intergenic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063585820 10:7351333-7351355 CTTAACCAGAAGAATGAGGATGG + Intronic
1064188267 10:13182717-13182739 TTTCATCTCTAAAATGAGAAGGG + Intronic
1064291675 10:14040082-14040104 CTCCATCTGTAAAACAAGGATGG - Intronic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1064893349 10:20205789-20205811 CCTCATCTGTAAGATGAGGTGGG - Intronic
1065263655 10:23952665-23952687 CCTAACCTGTAAAATGGGAATGG + Intronic
1065485664 10:26234356-26234378 CTTCATCTGTAAAACAAGGTGGG - Intronic
1065963057 10:30749977-30749999 CCTCACCTGTAAAAAGAAGAAGG - Intergenic
1067471070 10:46538290-46538312 CTTCATCTATAGAATGAGGATGG - Intergenic
1067793058 10:49302082-49302104 CTTCACCTGAAGCTTGAGGAGGG + Intronic
1067794223 10:49309017-49309039 CATCAGCTGTAAGATGATGAGGG + Intronic
1068154554 10:53181366-53181388 CCTTACATGTAAAATGAGGGAGG - Intergenic
1068831838 10:61505069-61505091 CCACACCTGGAAAATGATGAAGG - Intergenic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069283344 10:66682939-66682961 CACAACCTGTGAAATGAGGAGGG - Intronic
1069310667 10:67032042-67032064 CTTTTCCAGTAAAATGAGGTAGG + Intronic
1069542588 10:69306530-69306552 GTTCACATGTGAAATGAGGAGGG + Intronic
1069694215 10:70374930-70374952 CTTCATCTATAAAATGGGAATGG - Intronic
1069702162 10:70434846-70434868 TTCCACCTGTAAGATGAGGAGGG - Intronic
1070115374 10:73523745-73523767 CCTCACCTGTAATATAAGCAAGG + Exonic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070773824 10:79098446-79098468 CCTCACCTGTAAAATGGAGGTGG + Intronic
1070887085 10:79910946-79910968 CTTGACCTTTAAAATGAAAATGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071393298 10:85196663-85196685 CTTCACTTGCAAATTGAAGATGG + Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1071693848 10:87851523-87851545 CTTCATTTGTAAAATGAGATTGG + Intergenic
1072254209 10:93605268-93605290 TCTCACCTGTAAAATGATAATGG + Intergenic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074209910 10:111320993-111321015 CTTGAAATGTAAAATGAGGCAGG + Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074942740 10:118250815-118250837 CATGACCTGTTAAATGAAGATGG + Intergenic
1075585731 10:123656753-123656775 CTCCACCTGCGAAATGAGGTGGG - Intergenic
1075739087 10:124682511-124682533 TCTCATCTGTAAAATGAGGTTGG - Intronic
1076127619 10:127987818-127987840 CTTCAAATGAAAAATGAAGAGGG - Intronic
1076161755 10:128249333-128249355 CTTCATCTGTTGAATGAAGAAGG + Intergenic
1076641713 10:131921296-131921318 CTGCACCTGCAAAGTGAGGCTGG - Intronic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1078351988 11:10602375-10602397 TTTCAAGTATAAAATGAGGATGG - Intronic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078467881 11:11563591-11563613 CCTCACTTGTGACATGAGGATGG - Intronic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1078974550 11:16457538-16457560 CTTCATCTGTTAAATGGGTATGG - Intronic
1079016026 11:16869445-16869467 CTTCATCTCTAAAATGGTGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079311588 11:19371386-19371408 GTTAACCTGTAAAATGAGGGAGG - Intronic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080572005 11:33565224-33565246 CTTCCCCTGAAAAATGTGGCAGG - Intronic
1080692353 11:34568810-34568832 CCTCCCCTGTAAAATGGGCAGGG + Intergenic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1082013207 11:47464889-47464911 GCTCATCTGTAAAACGAGGATGG + Intergenic
1082265323 11:50111602-50111624 ATTCAGCTGGAAAGTGAGGAGGG + Intergenic
1082279976 11:50261273-50261295 CTGCACCTGTAATATGACTAAGG - Intergenic
1082974860 11:59061396-59061418 CTCCAACTGAAAAATAAGGAGGG - Intergenic
1082979283 11:59105126-59105148 CTCCAACTGAAAAATAAGGAGGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083186794 11:61022328-61022350 CCTCACCTGTAAAATGAGAGTGG - Intergenic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275884 11:61596876-61596898 CTCCACCTGTAAAATGGAGATGG - Intergenic
1083392715 11:62366483-62366505 CTTTACCTGTTAGATAAGGAAGG - Intronic
1083395072 11:62385138-62385160 CTTTACCTGTTAGATAAGGAAGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085473598 11:76773904-76773926 TCCCACCTGTAAAATGAGAAAGG + Intergenic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085706166 11:78788389-78788411 CTTCAGCTGTAAAGTGGGAAGGG + Intronic
1085735154 11:79032361-79032383 CTTCACCTGTAAGATAAAGCAGG - Intronic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086116045 11:83251472-83251494 CTTCATTTATAAAATGAAGATGG - Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086325706 11:85696669-85696691 CTTCATCTATAAAATGGGAATGG + Intronic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087101428 11:94369048-94369070 CTTCAGCTGAAATATGAGGAAGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087920237 11:103858587-103858609 TGTAATCTGTAAAATGAGGAAGG + Intergenic
1088142054 11:106629353-106629375 CTTAATCTGTCAAATGAGGGGGG - Intergenic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088455241 11:110026558-110026580 TTTCAACTGTAGAATGAGGGAGG - Intergenic
1088461446 11:110087623-110087645 ATTCACCTGTTAAAAGAGGGTGG - Intergenic
1088916497 11:114231894-114231916 CCTCAACAGTAAAATGAAGAGGG - Intronic
1089015038 11:115158633-115158655 CATCATCTGTAAAATGAGGCTGG - Intergenic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1090621689 11:128566415-128566437 CTTCATCTGTAAAATAGGCATGG - Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1091578120 12:1758440-1758462 CCTCACTGGTAAATTGAGGAAGG - Intronic
1091650559 12:2305982-2306004 CTTCAACTGTAAAGTGGAGAAGG - Intronic
1091765398 12:3117033-3117055 CTTCACCTTTACAAGCAGGATGG + Intronic
1091782648 12:3223667-3223689 CCTCACCTATAAAATGGGAAGGG + Intronic
1091786388 12:3245552-3245574 GGCCACCTGTAAACTGAGGAGGG + Intronic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092607923 12:10140028-10140050 CTTCACCAGTAAAATGATAATGG + Intergenic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1092984594 12:13833731-13833753 CTGCATCTGTAAAATGGGGTAGG - Intronic
1093673540 12:21905815-21905837 CTTCATCAGTAAAATGAAGATGG - Intronic
1093828651 12:23727519-23727541 CTTGCCTTGTCAAATGAGGATGG - Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096718798 12:53506338-53506360 CATCACCAATAAAATGAGGACGG - Exonic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1098068928 12:66650928-66650950 CTTCATCTCCAAAATGAGCATGG + Intronic
1098505360 12:71243148-71243170 TTTCACATGTAAAAAGAGGAGGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1099273671 12:80547874-80547896 CTTCATCTGTAACATGGGAATGG - Intronic
1099287523 12:80733027-80733049 CATAACCTGTAAAATGATGCAGG - Intergenic
1100403745 12:94254524-94254546 TTTCACTTGTAAAATGAGTAAGG + Intronic
1100483003 12:94997311-94997333 CTTCATCTGTGAAATGGGGGCGG + Intronic
1100585257 12:95973417-95973439 CCTTATCTGTGAAATGAGGAAGG + Exonic
1100856374 12:98761053-98761075 TCTCACACGTAAAATGAGGATGG - Intronic
1100883167 12:99040627-99040649 CTTAACCTGTAAAATGGGAATGG + Intronic
1100962708 12:99981704-99981726 CTTCATCTGTGAAATGACAATGG + Intronic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101659724 12:106754887-106754909 CTCCATCTGTAAAATGGGGTGGG + Intronic
1101719800 12:107341482-107341504 CTTCAGCTGTTAAGTGAGGGAGG + Intronic
1101750207 12:107577269-107577291 CTTCACCTGTAAAGTGGGGTGGG - Intronic
1101849570 12:108391354-108391376 CCTCAACTATAAAATGAGAATGG + Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102738025 12:115180415-115180437 CCTCACTTGTAAACTGAGGATGG + Intergenic
1102801690 12:115740670-115740692 CTCCATCTGTAAAATGGGGGTGG + Intergenic
1102839850 12:116107045-116107067 CTTCACCAGTAACATGGTGAAGG - Intronic
1102912558 12:116728734-116728756 CTTCCTCTGTAAAATGGAGATGG - Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103159029 12:118712169-118712191 CCTCACCTGTAAAATAGAGATGG + Intergenic
1103189839 12:118991947-118991969 CTCCACGTGTAAAATGAGATCGG - Intronic
1103598643 12:122040116-122040138 CTCCATCTGTAAAATGCGGTTGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104157515 12:126148165-126148187 CTCCATCTGGAAAATGAGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106127122 13:26909622-26909644 CTTCACCTGTCAGATGAAAAGGG - Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107616233 13:42171210-42171232 TTTCACCAGTAAAATGGAGATGG - Intronic
1107637542 13:42407655-42407677 CTTAACCTGTAAAATGAAGTTGG + Intergenic
1108446295 13:50512144-50512166 CTTCAGCTGAGAAAAGAGGATGG + Intronic
1109862170 13:68214238-68214260 CTTCATCTGTAAAATGAAGTGGG + Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1111323927 13:86666475-86666497 CCTCACTTCTAAAATAAGGATGG - Intergenic
1111371835 13:87329217-87329239 CTTTGCCTGTATAATGAGTAAGG - Intergenic
1111771046 13:92596100-92596122 CTTCATCTGAAAAATTAAGAGGG - Intronic
1112268156 13:97944788-97944810 CTTCGCCTATAAAATGAGACTGG - Intergenic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1113963829 13:114140508-114140530 CTTCGTCTGTAAAATGGGGCTGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114416295 14:22546849-22546871 TTTCACCTGCAAAATGAATATGG - Intergenic
1114862456 14:26541271-26541293 CTTTCCCTGTAACATGAGTAAGG + Intronic
1114862900 14:26548301-26548323 GTTTACTTGTAAAATGAGGTAGG - Intronic
1115378977 14:32711878-32711900 CTTCATCTGTAAAGTGAGGGGGG + Intronic
1115508018 14:34111217-34111239 CTTCAACTAGAACATGAGGATGG - Intronic
1115542075 14:34430328-34430350 GTTCACCTGTTAAATAGGGATGG - Intronic
1115675583 14:35669552-35669574 CTTCATCTATAAAATAAAGATGG - Intronic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1116835630 14:49767388-49767410 CCTCACCTGTAAAATAGGGTGGG - Intergenic
1116853935 14:49935508-49935530 CTCCATCTGTAAAATGAAGATGG + Intergenic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1117800056 14:59433984-59434006 CTTCACGTGTTAAAAGAGGACGG - Intronic
1117947876 14:61049467-61049489 CTACATCTTTAAAATGGGGATGG - Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118160731 14:63287332-63287354 CCTGAGCTGTGAAATGAGGATGG + Intronic
1118314148 14:64715514-64715536 CCTGACCTGTAAAATAGGGATGG + Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118349954 14:64966666-64966688 CTGCATCTGTAAATTGAAGATGG - Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118657811 14:67971832-67971854 CTCCATCTGTAAAATGATAATGG + Intronic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1119893539 14:78200974-78200996 CTTCATCCGTGAAATGAGGCTGG + Intergenic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1119899353 14:78246719-78246741 AGTCACCTGTAAAATGTGAAGGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1120674614 14:87406452-87406474 CCTCACCTGTAAAGTGAGCACGG + Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1120983301 14:90310382-90310404 CCTCATTTGTAAAATGAAGAGGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121230809 14:92356565-92356587 CTCCAACTGTAAAATGGAGATGG + Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1121288745 14:92757300-92757322 CATCACCTGGAAGATGAGGGAGG + Intergenic
1121563049 14:94888227-94888249 CCTGACCTGTACAATGAGCATGG + Intergenic
1121916198 14:97838649-97838671 TTTCATTTGTAAAATGATGAAGG + Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122104969 14:99446144-99446166 CCTCACTTATAAAATGGGGACGG + Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122306165 14:100768176-100768198 CTCCCCCTGTAAAATGAAAAGGG + Intergenic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124618756 15:31262101-31262123 TTTCCTCTGTAAAATGAGGTAGG + Intergenic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124925658 15:34067861-34067883 CTTTACCAGTAAAATGATGTGGG - Intergenic
1125180189 15:36873702-36873724 CTTCACCTATAAAATGAAACTGG - Intergenic
1125351294 15:38770156-38770178 CTTTACCTCTAAAATAAGGGAGG + Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1126711073 15:51456793-51456815 ATTCATCTGTAAAATGATAATGG + Intronic
1127394114 15:58529821-58529843 CTTCAACTGTGACATAAGGAAGG + Intronic
1127631935 15:60835627-60835649 CTTCACCTGTAAAATAGAGATGG - Intronic
1127675427 15:61233550-61233572 CCTCACCTATAAAATGGGCATGG - Intergenic
1128347355 15:66862901-66862923 CTCCACATGTAAAATGAGGCAGG + Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128691966 15:69731455-69731477 CATCAACTGTAAATTGGGGAGGG + Intergenic
1128725703 15:69987023-69987045 CCCCATCTGTGAAATGAGGAGGG - Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128765339 15:70247920-70247942 CCTCACCTGTAAACAGAGGAGGG - Intergenic
1128790519 15:70430079-70430101 CATCTCCTTCAAAATGAGGATGG - Intergenic
1128793005 15:70446893-70446915 CCTCATCTGTAAAACAAGGATGG + Intergenic
1128802214 15:70504120-70504142 CTTCTGCTGTAAACAGAGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1129678400 15:77644509-77644531 CGTCACCTGGGAAATAAGGATGG + Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1129745725 15:78019318-78019340 CTTCACCTCAAAAATAAAGATGG - Intronic
1130094158 15:80843899-80843921 CTTCTTCTGTAAAACAAGGAGGG - Intronic
1130123903 15:81076131-81076153 CTTCAATTGCAAAATTAGGAAGG - Intronic
1130132460 15:81155600-81155622 CCTCACCTGTAAAATGACCGGGG - Intergenic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1130927039 15:88393300-88393322 CTTTATCTGTAATATGAGGATGG + Intergenic
1131469672 15:92685002-92685024 CCTCCCCTGTAAAATAAGGATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131533780 15:93216695-93216717 CTTCATTTGTAAAGTGAAGATGG + Intergenic
1131552130 15:93366070-93366092 ATTCAAGTGTAAACTGAGGATGG + Intergenic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132336939 15:101053686-101053708 ATTTGCCTGTAAAAGGAGGATGG + Intronic
1132564180 16:613189-613211 CCTCACCTGTAGAATCAGCAGGG + Intronic
1133331787 16:4979402-4979424 CTCCATCTGTCAAATGCGGAGGG + Intronic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1134158335 16:11862911-11862933 CTTCATCTGTTAAATGAAGCTGG + Intergenic
1134201143 16:12200122-12200144 TTTCATCTGTACAATGAGGTTGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134874683 16:17687346-17687368 CATCACCTGTAAACTGGGTATGG - Intergenic
1135155538 16:20049769-20049791 CTTTATCTGTAAAGTGGGGATGG + Intronic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136099156 16:27980567-27980589 CTTCATCTGTAAAATGGGTGTGG - Intronic
1136175201 16:28511929-28511951 CTTCAGATGTGACATGAGGATGG + Intronic
1136237369 16:28923002-28923024 CTTCCTCTGTAAAATGGAGATGG + Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136450903 16:30353795-30353817 CTTCACCTGTAATGGGAAGATGG + Exonic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136517085 16:30774741-30774763 CAGCACCTGCAAGATGAGGAAGG - Exonic
1136577740 16:31134381-31134403 CCTCACCTCTAAAATGAAGCTGG - Intronic
1136624834 16:31456000-31456022 CTTCATCTGTAAAACAGGGATGG - Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137013465 16:35347311-35347333 CTTCACTGGTAATGTGAGGAGGG - Intergenic
1137020431 16:35420214-35420236 CTTCACTGGTAATGTGAGGAGGG - Intergenic
1137413740 16:48252299-48252321 CAACACCTGTAAAATGAGGGAGG + Exonic
1137586854 16:49668884-49668906 CCTCAACTATAAAATGAAGATGG + Intronic
1137598691 16:49741866-49741888 CCTCACCTAGAAAATGAGGATGG + Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137695682 16:50460662-50460684 CTTCACCTGTGAAATGAAGGGGG - Intergenic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1137943763 16:52714450-52714472 TCTGACCTGGAAAATGAGGAGGG - Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138739629 16:59292999-59293021 CTCCACCTCTAAAATGAAAAAGG - Intergenic
1138821025 16:60260070-60260092 CTTCACCTGTAAAAGTAAGGAGG + Intergenic
1138833398 16:60403401-60403423 GTTCAACTGTTAAAAGAGGAAGG - Intergenic
1138982225 16:62283224-62283246 CTTCACCTGTAAGATTGGGGAGG - Intergenic
1139400370 16:66676541-66676563 CCTCACCTGTAAAACAAGGGAGG + Intronic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1139588968 16:67922674-67922696 CTTCACTTTTAACACGAGGAAGG - Intronic
1139656414 16:68389717-68389739 CTTCAACTGTAGCATGAGGCTGG - Intronic
1140071134 16:71650834-71650856 CTTCATCTGTAAAATGAAAATGG + Intronic
1140739801 16:77931007-77931029 CTAAATCTGTAAAATGAGGAGGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141313754 16:82940307-82940329 TTCCACCTGTAAAATGGAGACGG + Intronic
1141333919 16:83137350-83137372 TTCTACCTGGAAAATGAGGAAGG + Intronic
1141479630 16:84297808-84297830 CCTCACCTGGGAAATGAAGATGG + Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1141844275 16:86596528-86596550 CCCCACCTGTAAAATTAGGTTGG - Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1142043142 16:87908291-87908313 CTCTACCTGTTAAATGAGAAGGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1142895187 17:2971664-2971686 CCTCATCTGTGAAATGATGATGG + Intronic
1143439304 17:6956110-6956132 CTTCATCCATAAAATGAGGATGG + Intronic
1143833804 17:9673908-9673930 CTTCTTCTGTACAATAAGGAGGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144761649 17:17710675-17710697 CTCCACCTCTGAAATGAGGAGGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1144952073 17:18999845-18999867 CCTCAACTGTGAAATAAGGAAGG + Intronic
1145142403 17:20456157-20456179 CGTCATCTGTAGAATGAGCATGG - Intronic
1145309335 17:21692910-21692932 CTTCCCCTGAAAAATGAGGCTGG - Intronic
1145772818 17:27505614-27505636 CTTTATCAGTAAAATGGGGATGG + Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146270996 17:31485783-31485805 CTTCATCTGTAAGATGGGAATGG - Intronic
1146563189 17:33889232-33889254 CTTCATCTGAAAAACGAGGGGGG - Intronic
1146637649 17:34518189-34518211 CTGCATCTGTTAAATGGGGATGG + Intergenic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147043591 17:37736434-37736456 CTTCATCTGTAAAATGGAGGTGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147171128 17:38619575-38619597 CTTCATCTGTAAAATGGGCCTGG + Intergenic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1147808104 17:43146903-43146925 GTTCCCATCTAAAATGAGGAGGG - Intergenic
1148279580 17:46337590-46337612 GTTCCCATCTAAAATGAGGAGGG + Intronic
1148301797 17:46555446-46555468 GTTCCCATCTAAAATGAGGAGGG + Exonic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148365719 17:47054433-47054455 GTTCCCATCTAAAATGAGGAGGG + Intergenic
1148804767 17:50258655-50258677 CCTCACCTGTAAAATGGGATGGG - Intergenic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1149600396 17:57889558-57889580 CTTCACCTGTAATGTGAGGCAGG - Intronic
1150285431 17:63951313-63951335 CTCCAGCTGTAAAATGGGGGTGG - Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150400819 17:64854707-64854729 GTTCCCATCTAAAATGAGGAGGG - Intronic
1150781000 17:68122109-68122131 GTTCCCATCTAAAATGAGGAGGG - Intergenic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151701082 17:75742891-75742913 CTCCATCTGTAAAATGGGTAAGG + Intronic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153133241 18:1882074-1882096 CATCACAGGTAAAACGAGGAAGG - Intergenic
1153415527 18:4841746-4841768 CCTTACCAGTAAAATGAGGATGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153811152 18:8752989-8753011 CTGCTCCTGTATAAAGAGGATGG + Intronic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1154091415 18:11367351-11367373 CATCACCTGTGACATGAAGAGGG - Intergenic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156190923 18:34719425-34719447 CTTCATCTGTAAAATAAAGATGG - Intronic
1157165382 18:45354036-45354058 CTTCATCTGTAAAATATTGAAGG + Intronic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157583939 18:48789324-48789346 CCTCACTGGTAAGATGAGGATGG + Intronic
1157932847 18:51842209-51842231 ACTCAACAGTAAAATGAGGATGG - Intergenic
1158261915 18:55615594-55615616 CTTTCCCTCTAAAATCAGGAAGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159052042 18:63429418-63429440 CTGCATCTGTAAAATGGGGGTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159672784 18:71242836-71242858 CTTCACCTGTAATTTTAGGATGG + Intergenic
1159863715 18:73680542-73680564 TTTCATCTGTAAAATGAGCATGG - Intergenic
1160557995 18:79738437-79738459 CCTCACCTGTGAAATGAGGTAGG + Intronic
1160565737 18:79785758-79785780 CCTCACCTGTGCAATGAGAAGGG + Intergenic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1162056014 19:8064541-8064563 TTTTCCCTGTAAAATGGGGATGG + Intronic
1162082372 19:8225890-8225912 GTTCATCTGTGAAATGAGAATGG + Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166156953 19:40920906-40920928 CTCCATCTATAAAATGGGGATGG + Intergenic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166166020 19:40989380-40989402 CTCCATCTATAAAATGGGGATGG + Intergenic
1167087632 19:47321003-47321025 GTTCACCTTGCAAATGAGGAAGG - Exonic
1167145181 19:47677080-47677102 CCTCGTCTGTGAAATGAGGAAGG + Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167667407 19:50830804-50830826 CTTCCCTTGTCAAATGAGGTCGG + Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168483728 19:56742917-56742939 CTTTACCTGTAAGTGGAGGATGG + Intergenic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
1168492289 19:56821160-56821182 CCTCATCTGTAAAATGAATATGG - Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925641853 2:5993038-5993060 CTTCTCCTGTAGAAAGGGGAAGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926861685 2:17316831-17316853 CTTCACCTGATAAATGGGGTAGG + Intergenic
926868117 2:17381868-17381890 CTTCATCTATAAAATAAAGAGGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926946930 2:18198577-18198599 CTTCATCTGTGAATTGAGGCAGG - Intronic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927709463 2:25315627-25315649 CGTCACCTGTAAACTGGGCACGG - Intronic
927973955 2:27323708-27323730 CTGCATCTGTAAAATGAGGGAGG + Intronic
928201498 2:29250295-29250317 CCTCATTTGTAAAACGAGGATGG + Intronic
928205778 2:29282373-29282395 CTTCAGCTCTAAGATGAAGATGG + Intronic
928540188 2:32277515-32277537 CCTCACCTGTAAGATGAAGAGGG - Intergenic
928974370 2:37068925-37068947 ATACGCCTGTAAAAAGAGGAAGG + Exonic
928999352 2:37330372-37330394 CCTTACATGTAAAATGAGGGGGG + Intergenic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
929584497 2:43105305-43105327 CTTCACCCCTAAAGTGATGAAGG + Intergenic
929666842 2:43839969-43839991 CTTCTCAGGTAAAATGAGGAAGG - Intronic
929693159 2:44091364-44091386 CTTCCCTTGTAAAACGAGGATGG - Intergenic
929870942 2:45758867-45758889 CCTCACCTGTAAAGTGCAGAGGG + Intronic
930034588 2:47077520-47077542 CTTCATCTGTACAATAAGAATGG + Intronic
930057449 2:47263014-47263036 TTTCACAGGTAAAATGAGAATGG + Intergenic
930247434 2:48999300-48999322 CCTCAACTCTAATATGAGGATGG - Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
931859326 2:66337665-66337687 CCTTATCTGTAATATGAGGAGGG + Intergenic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932096072 2:68849933-68849955 CATCACCAGAAAAATGAGGGTGG - Intergenic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932299843 2:70658748-70658770 CTGCATGTGTAAAATGAGTAAGG + Exonic
932414558 2:71565759-71565781 TATCATCTGTAAAATGAGGGTGG + Intronic
932877266 2:75465999-75466021 CTTCAACTGTAACATGAAGATGG - Intergenic
933267164 2:80193485-80193507 CTGCATCTGTAAAATGGAGAAGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933851171 2:86367850-86367872 CCTCACCTGTAAAACAGGGATGG + Intergenic
934896655 2:98125477-98125499 CTTCATCTGTAAACTGGGCATGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935641704 2:105297075-105297097 GCTCACAGGTAAAATGAGGATGG - Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
936613394 2:114024105-114024127 CTTGACCTGTAAAATAAGCAGGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937279533 2:120707873-120707895 CTTCTCCTCTAAAATGAAGCTGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
938161174 2:128985893-128985915 TTTCATCTGTGAAATGAGAATGG - Intergenic
938744752 2:134266920-134266942 CTTCTCCCTTAAAATGAAGACGG - Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
939507390 2:143063713-143063735 CTTCACATATAAAATGAAGATGG - Intergenic
939620493 2:144413025-144413047 CCTCATCTGTAAAATGAGCCAGG + Intronic
939621127 2:144420482-144420504 CTTCAGCTGAAAAATGAGGGTGG - Intronic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
940332078 2:152485811-152485833 CTTTACCTGTAGAATGAGAGGGG - Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
940969467 2:159879762-159879784 CCTCACGTGTAAAATGATGATGG + Intronic
941049853 2:160720678-160720700 CCCCACCTGTAAAATGGAGATGG + Intergenic
941129374 2:161627031-161627053 CTTCAACTGAAAAATGAAAAGGG + Intronic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
942368891 2:175259336-175259358 CCTTACCTGTAAAATGGGAATGG - Intergenic
942942576 2:181636520-181636542 CTCAACCTGAAAATTGAGGAAGG - Intronic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
944477347 2:200120423-200120445 CCTCACCTTTGAAATGAGGGAGG - Intergenic
944549009 2:200828587-200828609 CTGAACCTGTAAAATGAGAATGG + Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944633062 2:201647194-201647216 TCTCATCTGTAAAATGATGATGG - Intronic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945112062 2:206369340-206369362 CCTCATTTGTGAAATGAGGAAGG + Intergenic
945142578 2:206702694-206702716 CTTCATTTGTAAAATAAGGTGGG + Intronic
945840529 2:214882319-214882341 CCTCTGCTGTCAAATGAGGAAGG - Intergenic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948351252 2:237343007-237343029 TTTCACCTGTAAATTGAGACTGG - Intronic
1168870653 20:1125391-1125413 CTTCATCTGTGAAGTGAGGTGGG + Intronic
1168927061 20:1590527-1590549 CCTCGCCTGTAAAAGGAGGTAGG - Intronic
1169907949 20:10622557-10622579 CTACACCTGAAAAAGGAGGCAGG - Intronic
1170039750 20:12027511-12027533 ACTCACCTGTAAAATGAAGGAGG - Intergenic
1170057726 20:12225222-12225244 CTTCATCTGTGAAATGAGTACGG + Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170401481 20:15989027-15989049 CTTCATCTGTAAGATGATGATGG + Intronic
1170415011 20:16130263-16130285 CTTCATCTGCAAAATGAAGGTGG - Intergenic
1170683440 20:18547267-18547289 CCTCACCTGTAAACTAGGGATGG + Intronic
1171213337 20:23333983-23334005 CATCACCTGCAAAATGATCAAGG + Intergenic
1171225470 20:23438774-23438796 CTTCACCTGTAATATGAGAATGG - Intergenic
1171387800 20:24781851-24781873 CCTCACCTGTGTAATGAGGGTGG - Intergenic
1171794252 20:29554200-29554222 CCTCACCAGTAAAAAGAGGGAGG - Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1172034887 20:32003602-32003624 CTTTATCTGTAAAATGAGTTTGG - Intergenic
1172114312 20:32564668-32564690 CTTCATCTGTAAAATGGGCTAGG + Intronic
1172311468 20:33921571-33921593 TCTCGTCTGTAAAATGAGGACGG - Intergenic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172907538 20:38380040-38380062 CCTCTCCTGTCAAATGAGGCTGG + Intergenic
1173547065 20:43905965-43905987 CCTGACCTGTAAACTGGGGATGG + Intergenic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173644009 20:44622427-44622449 CCTCATTTGTAAGATGAGGACGG + Intronic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174241916 20:49143184-49143206 CATTCCCAGTAAAATGAGGAAGG + Intronic
1174305060 20:49609173-49609195 CTTCACCTGTAAGGTGGGGTAGG + Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174549834 20:51354436-51354458 CTTCACCTTTAAGGTGAAGACGG - Intergenic
1174648078 20:52103234-52103256 CACCACCAGTAAAATGACGAAGG - Intronic
1174813868 20:53670113-53670135 TTTCATCTGTAAAATAAGAAAGG + Intergenic
1175177934 20:57124690-57124712 CGTTATCTATAAAATGAGGAAGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1176996765 21:15563831-15563853 CTTCAGCTAATAAATGAGGAAGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1177922337 21:27167926-27167948 CCTCACCTGTAAAATAGGAATGG + Intergenic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178813292 21:35904458-35904480 CTTCAACTCTAAAATCAGAAAGG + Intronic
1179237696 21:39562127-39562149 CTTCATCTATAAAATGATGATGG + Intronic
1179249582 21:39661772-39661794 CCTTGCCTGTAAAATTAGGATGG - Exonic
1179293523 21:40040753-40040775 CTGCATCTGTAAAATGGGAATGG - Intronic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1181423675 22:22819154-22819176 CAGCACCTGTAAAGTGAGCAAGG - Intronic
1181862304 22:25828597-25828619 CCCCAACTGTTAAATGAGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1181949392 22:26543075-26543097 CTTCAGCTGCAAAATCAGGGTGG + Intronic
1181980732 22:26764157-26764179 CTTCCCCTGTAACATGAGGGAGG - Intergenic
1181999845 22:26911372-26911394 CTTCTCCTGTAACATGAAGGAGG - Intergenic
1182086381 22:27563917-27563939 CCCCATCTGTAAAATGAAGAGGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182243021 22:28932267-28932289 CCTCACCTGTAAAATAAGGCCGG + Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182287574 22:29257419-29257441 CTTCACCTGTAAAATGGCCACGG - Intronic
1182509051 22:30806125-30806147 CTTCATTTGTATAATAAGGATGG - Intronic
1182834080 22:33327328-33327350 CCTCACCTCTGAAATGAAGAAGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183444671 22:37845442-37845464 CCTCACCTATAAAATAGGGATGG - Intronic
1183594403 22:38801669-38801691 CTTCATCTATAAAATGGGAAGGG + Intergenic
1183742235 22:39675179-39675201 CCTTGCCTGTGAAATGAGGATGG + Intronic
1184121395 22:42452771-42452793 CTTCACCTGTGAGGTGGGGATGG + Intergenic
1184128584 22:42503818-42503840 CCGCACGTGTAAAATGAGGTTGG + Intergenic
1184137378 22:42557133-42557155 CCGCACGTGTAAAATGAGGTTGG + Intronic
1184384835 22:44168079-44168101 CTTCATCTGTAAAATGGGCCTGG - Intronic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184606255 22:45576414-45576436 CCTCACCTGTAAGGTGAGGAAGG - Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949664646 3:6323223-6323245 TTTCGTCTGTAAAATGAGCATGG - Intergenic
949876251 3:8627901-8627923 CTTCATCTGTAAAATGGTGCGGG + Intronic
949943104 3:9169930-9169952 CCTCTCCTGTAAAATGAAGGGGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
950706456 3:14785519-14785541 CCTCACCTGTACAATCAGGGAGG - Intergenic
951037449 3:17949662-17949684 CATCACCTGTATTATGATGAGGG + Intronic
951450986 3:22837783-22837805 CTTCACCAGTCAAATGAAGTGGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951589442 3:24247434-24247456 CCCCAACTGTAAAATGTGGATGG - Intronic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953203412 3:40798424-40798446 CTTCATCCATAAAATGGGGATGG + Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953591709 3:44262923-44262945 CCTCACATGCAAAATGAGGGTGG - Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954845177 3:53549495-53549517 CCTCAGCTGTAAAATGAGGTAGG + Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955842573 3:63128012-63128034 CCTCATCTGTGAAATGAGCATGG - Intergenic
955867801 3:63403545-63403567 TCTCATCTGTTAAATGAGGATGG - Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956546948 3:70415055-70415077 TGTCAACTGTAAAATGAGGGGGG + Intergenic
956633781 3:71342982-71343004 ATTCACCTGTAACATGAAGGTGG + Intronic
956686105 3:71828985-71829007 CTTCATCTTTAAAATGAAGGTGG + Intergenic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956737448 3:72248596-72248618 CCTCACCTCTACAAAGAGGATGG - Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
957194228 3:77047314-77047336 CCTTACCTGTAAAATGGGCATGG + Intronic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
958683839 3:97366998-97367020 CTTCATCTGTCATAAGAGGATGG - Intronic
959226159 3:103587911-103587933 CTTCACCACTGAAAGGAGGATGG + Intergenic
959576149 3:107936141-107936163 CTTCACCTCTTATATGGGGAAGG + Intergenic
959795690 3:110425809-110425831 CTTCACCTTTAACGTAAGGAGGG + Intergenic
960100450 3:113736988-113737010 CATCATCTGTAAAATGAAGGGGG - Intronic
960180443 3:114569440-114569462 CTTAACCTGAGAAATGAGGCAGG + Intronic
960376744 3:116911760-116911782 CTTCAACTGGAAAATGAGAAAGG + Intronic
960948327 3:122982189-122982211 CTCCACATGGGAAATGAGGAAGG - Intronic
960996401 3:123343373-123343395 CCTCACCTGTAACATGGGGTGGG - Intronic
960997238 3:123348281-123348303 GCTCGTCTGTAAAATGAGGATGG + Intronic
961846474 3:129768753-129768775 CTTCATCTGTAAAATAAAGGTGG + Intronic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
962488474 3:135867371-135867393 CTTCACCTGTAATATGATCCTGG + Intergenic
962869666 3:139477014-139477036 TCTCATCTGTAAAATAAGGATGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963261800 3:143200074-143200096 TTTCACCTGTAATATGAGGAAGG + Intergenic
963450996 3:145481845-145481867 CTTGGCCAGTAAAATGAGGCAGG - Intergenic
963643768 3:147888805-147888827 CCTCACCTGTTAAATGAAGATGG - Intergenic
964091052 3:152876012-152876034 TTCCATCTGTAAAATGAGGGTGG - Intergenic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
965365252 3:167790355-167790377 CTTCACCTGAAAGATGAGAAAGG - Exonic
965479491 3:169200095-169200117 TTTGACCTTTGAAATGAGGAAGG - Intronic
965633398 3:170756368-170756390 CTACCTCTGTAAAATAAGGAGGG - Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965847009 3:172974808-172974830 CTTCAACTGGAAAGTGAGGATGG - Intronic
966207147 3:177416664-177416686 TGTCAACTGTAAAATGAAGATGG + Intergenic
966500126 3:180630039-180630061 CCTCACTTGGAAAATGAAGAGGG - Intronic
967342485 3:188415167-188415189 CTTCAGATGTAAAATACGGAGGG - Intronic
967366753 3:188695606-188695628 CTTCACCTGTAAATGGAGTTGGG - Intronic
967534889 3:190590644-190590666 TTTCACTTGTAAAATGGGAAGGG + Intronic
967610403 3:191499338-191499360 CTTCACCTGTAAAAAGAAGGGGG + Intergenic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969501721 4:7557354-7557376 CTTCATCTGTAAATTGGGGTTGG + Intronic
969524327 4:7696494-7696516 CCTCATCTGTAACATGAGGTTGG + Intronic
969625872 4:8305389-8305411 CTCCACCTGTAAAATGGGTGAGG - Intronic
969968922 4:11026249-11026271 CTTAACCTTTAAAATAAGGCTGG - Intergenic
970206317 4:13659039-13659061 CATCAGCTGTAAAATGAGGAGGG - Intergenic
970557226 4:17246399-17246421 CTTCACCTATAAAATGGAAACGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
971255974 4:25013628-25013650 TTTCACCTGTAAAATGAAGGTGG + Intronic
971297595 4:25411662-25411684 TCTCATCTGTAAAATGAAGATGG + Intronic
971465498 4:26954610-26954632 CTTCATTGCTAAAATGAGGAGGG + Intronic
971474477 4:27059148-27059170 CCTCACGTGTGAAATGGGGATGG + Intergenic
972336409 4:38110661-38110683 CTTCACATATAAAATGAGAATGG - Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
972724144 4:41731522-41731544 TCTCATCTGTGAAATGAGGATGG + Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973960213 4:56102393-56102415 CCTCATTTGTAAAATGAAGAAGG - Intergenic
974744374 4:66051755-66051777 CTTCATTTGAAAAATGATGATGG - Intergenic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
975828660 4:78346361-78346383 CTTGGCCTGTAAAATGCAGATGG - Intronic
975854882 4:78613759-78613781 CCTCACCTGTAAAGCCAGGATGG + Intergenic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976210254 4:82661386-82661408 CTTCAACTGTCAACTGACGAGGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976443153 4:85100184-85100206 CTTTATCTATAAAATAAGGATGG - Intergenic
976454677 4:85232684-85232706 TTGCACCTATAAAATCAGGAAGG - Intergenic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977235077 4:94498690-94498712 CATCCACTGTAAGATGAGGAGGG + Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
977704402 4:100054998-100055020 CTTCTCCTGTAGAATCAGCAGGG + Intergenic
977767107 4:100811952-100811974 CTGCAACTGGAAAATGATGAAGG - Intronic
978326732 4:107566155-107566177 AGTCACATGTCAAATGAGGATGG - Intergenic
978763651 4:112382046-112382068 TTTTCCCTGTAAAATGAGAAAGG - Intronic
979572878 4:122251155-122251177 CTTTACCTGTAATAGGAGTATGG + Intronic
979974459 4:127179585-127179607 CTTTACCTGTAAGATAAAGAAGG - Intergenic
980860219 4:138490369-138490391 TCTCACCTCTATAATGAGGAAGG + Intergenic
981113176 4:140958973-140958995 CTTCACCTGTTAAAATAGCAGGG - Intronic
981190502 4:141856858-141856880 GATCACCTGTGAAATGTGGATGG - Intergenic
981316314 4:143343137-143343159 CCTTACCTGTAAAATGGGGGAGG + Intronic
981700327 4:147600786-147600808 TGTCACCTGTGAAATGAGAAAGG - Intergenic
982186383 4:152805771-152805793 CTTCATCTGTAAGATGATAATGG - Intronic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
983711887 4:170728245-170728267 CCTTTCCTGTATAATGAGGAAGG - Intergenic
983891800 4:173037332-173037354 CTTCATCAGTAAAATGAGGTGGG - Intronic
984151455 4:176137977-176137999 CTTCACCTAAAAAATGTTGAAGG + Intronic
984247039 4:177287133-177287155 AGTCACCTGTAGAATGAGGAAGG - Intergenic
984272543 4:177565131-177565153 CTCCACCCATAAAATGAGGCTGG - Intergenic
984682614 4:182627288-182627310 CTTAATGTATAAAATGAGGATGG - Intronic
986240957 5:5959662-5959684 TTTCACTTGTTAAATGATGATGG - Intergenic
986696196 5:10357121-10357143 CCTAACCCATAAAATGAGGAGGG - Intronic
987333540 5:16878021-16878043 CTCCATCTGTAAAATGGGAATGG - Intronic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990131117 5:52585447-52585469 CTTCACCTGAAAAAAGCAGAAGG + Intergenic
990375423 5:55165811-55165833 CCTCACCTGTAAATTGAACAGGG + Intronic
990382795 5:55232967-55232989 CTCCATCTGTAAAATGAGGCCGG + Intronic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990543680 5:56800529-56800551 CTTCAAGTGTAAAATGCTGAAGG + Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
990696917 5:58428649-58428671 GTTGACCTATAAAATGATGATGG - Intergenic
990833679 5:59990037-59990059 CTTCACCTGTAAAACTCAGAAGG - Intronic
991019913 5:61969785-61969807 CTCCATCTGTAAAATGAAAATGG - Intergenic
991468106 5:66936315-66936337 CTTCACCTGTACAATGGAAATGG + Intronic
991485486 5:67131393-67131415 CTTCACCTGTAATACGAGGATGG - Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992009371 5:72511532-72511554 CTTCATCTGTAAAAAGGGCAGGG - Intergenic
992017761 5:72593399-72593421 CCTCACCTGTAAAATGCCTATGG - Intergenic
992630579 5:78676364-78676386 ATTCAGCTATAAAATGATGATGG - Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993090293 5:83417751-83417773 CTTCATCGATAAAATAAGGAAGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
994150025 5:96436661-96436683 CTTGACCTGTAAAATTTAGATGG - Intergenic
994798337 5:104335919-104335941 TTCCACCTGTAAAATGTGGGGGG + Intergenic
995037562 5:107552415-107552437 CCTCACCTATTAAATGAGGATGG - Intronic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
996155139 5:120090166-120090188 TCTCACCTGTAAAATGTGGTAGG + Intergenic
996297835 5:121944142-121944164 CGTCACCTGTAAAACTAGGGTGG - Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
996931600 5:128896002-128896024 CTTTGCCTGTAGAAAGAGGAGGG - Intronic
997277901 5:132613270-132613292 CTTCAGCTGAAAACTGAGAAAGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
998145375 5:139724839-139724861 CTTCATCCGTAAAATGACCACGG - Intergenic
998480224 5:142457025-142457047 CTCCACTTGTAAAATGAGGATGG - Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998831872 5:146168199-146168221 CTTCATCTGGAAAATCAGGGGGG + Exonic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999141150 5:149362950-149362972 CTCCATCTGTAAAATGAGATTGG - Intronic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000379128 5:160613183-160613205 CTTCACCTGGAAAATCAGGGTGG + Intronic
1000421643 5:161044817-161044839 TCTCACTTATAAAATGAGGATGG - Intergenic
1000776760 5:165429468-165429490 CTCCATCTAGAAAATGAGGACGG - Intergenic
1000937411 5:167319571-167319593 TTTCAACTGTACAATAAGGAGGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001949793 5:175808228-175808250 TTTCATCTATCAAATGAGGATGG + Intronic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002295484 5:178228584-178228606 CCCCACCTGTAAAATGAAGATGG + Intronic
1002352339 5:178591862-178591884 CTTGACCTGGAGGATGAGGAGGG - Intergenic
1002460570 5:179371510-179371532 TTTCATCTGTAACATGAGGATGG - Intergenic
1002638751 5:180620608-180620630 CATCTTCTGTAACATGAGGAGGG - Exonic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003166922 6:3687708-3687730 CAACCCCAGTAAAATGAGGAAGG + Intergenic
1003682878 6:8273017-8273039 CTTTACCTCTATAAGGAGGATGG + Intergenic
1003718733 6:8676514-8676536 CTTCATCTGTCAAATGAACAGGG - Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1003861884 6:10329963-10329985 CTTCACCTGTACGATGGGAATGG + Intergenic
1003938902 6:11004521-11004543 CTTCTCCTGTAAAATGACCTTGG + Intronic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004471780 6:15935928-15935950 CTCCACCTTGAAAATGAGGCTGG - Intergenic
1006453064 6:34116277-34116299 CCTCTCCTGTAAAATGGGGCCGG + Intronic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007910039 6:45504374-45504396 TTTCACCTGTAACATGGGAATGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1007946693 6:45833442-45833464 CTTCACATATAAAATGAGAATGG + Intergenic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1008476125 6:51937715-51937737 CTCCATCTGTAAAATGGGCATGG + Intronic
1010609073 6:77930343-77930365 ATGAACCTTTAAAATGAGGAGGG + Intergenic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1012977447 6:105795436-105795458 CTTCATCTATAAAACAAGGATGG - Intergenic
1013083382 6:106832578-106832600 CATCACCTCAAAAATGAGCATGG + Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1013521487 6:110937777-110937799 CTCCATCTGTAAACTGAGGGTGG + Intergenic
1014832273 6:126116703-126116725 TTTTAACTGTAAAATAAGGATGG + Intergenic
1015150328 6:130030280-130030302 CTTCAACTGTAAAATGGGTTAGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015167271 6:130211965-130211987 CTTCAACTGTAAAATGAAGTAGG - Intronic
1015254471 6:131162482-131162504 GTTCAGGTGTAAAATGAGGTGGG + Intronic
1015469894 6:133592462-133592484 GTTTACCTGTAATATGAGGAAGG - Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015797510 6:137027728-137027750 ACTAAGCTGTAAAATGAGGATGG - Intronic
1016492565 6:144623205-144623227 CTTCATCTGTAATATGAGAAAGG + Intronic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1016676328 6:146773607-146773629 CTTCATCTGTAAAACTGGGATGG - Intronic
1017094968 6:150796742-150796764 CTTCATCTATGAAATGGGGAAGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018344317 6:162885003-162885025 CTTCACCTCTAAAGTGAAGCAGG - Intronic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019854252 7:3588110-3588132 CCTTACCTGTAAAACGAGAATGG - Intronic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1021217919 7:17940239-17940261 GTTTACCTGTGAAATGGGGAAGG - Intronic
1021744682 7:23726979-23727001 CTGCATCTCCAAAATGAGGAGGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022039350 7:26565417-26565439 CTTGACCTGCACACTGAGGATGG + Intergenic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023733815 7:43217658-43217680 CTTTACTTGCAAAATGATGAGGG + Intronic
1023821714 7:43984312-43984334 CCCTATCTGTAAAATGAGGATGG - Intergenic
1023931521 7:44709160-44709182 CTCCCCCTGTCCAATGAGGAGGG - Intergenic
1023948990 7:44826172-44826194 CTTTGCTTGTAAAATGAGGCTGG + Intergenic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1024434992 7:49341819-49341841 CCTCACCTGGAAATTGAGAAGGG - Intergenic
1024474089 7:49792288-49792310 TTTTATCTGTAAAATGAGGATGG - Intronic
1024976566 7:55119039-55119061 CTTGAACTGTAAAATGAGCAGGG - Intronic
1025794302 7:64723618-64723640 CTGCATTTGCAAAATGAGGAAGG + Intergenic
1026052918 7:66961851-66961873 CCTCATCTGTAAAACAAGGATGG + Intergenic
1026521664 7:71123280-71123302 CTAGACCTTTAAAAAGAGGATGG + Intergenic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1028137559 7:87238297-87238319 CTTGATCTGTCAAATGGGGATGG + Intergenic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1029065639 7:97845148-97845170 CTTCAGCCATAAAATGGGGATGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1029749976 7:102537731-102537753 CCCTATCTGTAAAATGAGGATGG - Intergenic
1029767926 7:102636837-102636859 CCCTATCTGTAAAATGAGGATGG - Intronic
1030046802 7:105504548-105504570 CCTCATTTGTAAAATGAAGATGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030869079 7:114733509-114733531 CTTCTCCTCTACAATGGGGAGGG + Intergenic
1030926682 7:115465784-115465806 CTTTCTCTGTAAAACGAGGATGG - Intergenic
1031071277 7:117164872-117164894 GCTCATCTGTAAAGTGAGGAGGG + Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032403965 7:131642579-131642601 CTTCCCCTGGGAAATGAGCATGG + Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033193667 7:139308058-139308080 CTACACCTGGAATATGAGCAAGG - Exonic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033476395 7:141697284-141697306 CTTCTCTTGAAAATTGAGGAGGG - Intronic
1033755270 7:144393806-144393828 CTCCAAGTGCAAAATGAGGAGGG + Intergenic
1034150702 7:148913032-148913054 ATTCACCTGTAAAATGTGTTTGG + Intergenic
1034467214 7:151237191-151237213 CTTCACCTCTAAAATGCAGATGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1035074169 7:156167499-156167521 CCTCACCTGAGAAACGAGGATGG - Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1035905851 8:3509497-3509519 CCTCATCTTTAAAATGAAGAAGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036676527 8:10838845-10838867 CTGCCCCTGTAAAATCGGGATGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1038352214 8:26787032-26787054 CCTCATCTGTAAGATGAGGTTGG - Intronic
1038792887 8:30684274-30684296 GTTCCCATGTGAAATGAGGAAGG - Intronic
1039309538 8:36301366-36301388 ATTCACCTCTGAAATGAGAAAGG + Intergenic
1039783670 8:40813324-40813346 CTTCTTCTGTAACATGAGGTTGG - Intronic
1039823707 8:41155712-41155734 CTTCACCTGTAAAATGTTTGTGG - Intergenic
1040351548 8:46573660-46573682 CTTCAACCATAAAATGGGGATGG + Intergenic
1040365123 8:46707776-46707798 CTTCAACCATAAAATGGGGATGG - Intergenic
1040485307 8:47865581-47865603 CTTCATCTGTAAAAATAAGAGGG + Intronic
1040759879 8:50827318-50827340 CTTCACCTATAAAATTAGAATGG + Intergenic
1040984675 8:53280727-53280749 CTTCACATGTGAACTGAGGTTGG + Intergenic
1041009369 8:53526584-53526606 CTTCACCAGCAAAAAGATGATGG + Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041696045 8:60737466-60737488 TTTCATCTGTTAAATGAGGAGGG + Intronic
1041748761 8:61236766-61236788 CCTCATTTGTAAAATGAGGTCGG - Intronic
1042636123 8:70877414-70877436 TGTAATCTGTAAAATGAGGATGG - Intergenic
1042892153 8:73624552-73624574 CCTCATCTGTAAAATGAAGTGGG - Intronic
1042977059 8:74481097-74481119 CTTCAACTGTTAAATGAAAATGG - Intronic
1043323310 8:79017889-79017911 CTCTTCCTGTAAAAAGAGGAGGG - Intergenic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1043696434 8:83224691-83224713 CTTCAGCTGTAAATTTGGGATGG + Intergenic
1044011432 8:86998823-86998845 ATCTACCTGTAAAATGTGGATGG - Intronic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044570404 8:93711640-93711662 CTTAACCTGAAAAATGGGAATGG + Intronic
1044742514 8:95342401-95342423 CTTCAGCTGTAAAATGGAAATGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044928941 8:97233535-97233557 CTTCATCAGTAAAACGAGGACGG + Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045008163 8:97933957-97933979 CTTAACCTGTAAAAAGAGAGTGG - Intronic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1045375735 8:101572003-101572025 CCTTAGCTGTGAAATGAGGAAGG + Intronic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1046565749 8:115898626-115898648 CTTCACTTGTAAGATGAACAGGG - Intergenic
1046744137 8:117858982-117859004 CTTCACCAGCAAAATGATTATGG + Intronic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1046951142 8:120020756-120020778 CTTCACCTTTAAAATGATGCTGG + Intronic
1046971314 8:120226610-120226632 CTTCCTCTGTAAACCGAGGAAGG - Exonic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047254660 8:123206504-123206526 CTCCACCTGTGGAATGTGGAGGG - Intronic
1047371716 8:124261480-124261502 CTTCACCTCTTAACTCAGGATGG - Intergenic
1047411596 8:124628794-124628816 CCCCATCTTTAAAATGAGGATGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047706037 8:127500569-127500591 CCTCACCTCTAAAATGGAGATGG - Intergenic
1047742081 8:127814587-127814609 CAACATCTGTAAAATGAGGATGG - Intergenic
1047873030 8:129106091-129106113 CCTGGCCTGTAAAATGGGGATGG + Intergenic
1047874621 8:129122426-129122448 TTTCAACTATAAAATGAGAATGG - Intergenic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048136985 8:131756151-131756173 CCTCACCTGTATAATAAGAACGG + Intergenic
1048180274 8:132188010-132188032 CTTCATCTCTAAAATGGGAATGG - Intronic
1048590229 8:135814497-135814519 CTGCATCTGTAAAATGATGATGG - Intergenic
1049564988 8:143333536-143333558 CTTCATCTGTGAAATGAGACTGG - Intronic
1050351218 9:4741967-4741989 CCTCTCCTGTAAAATGAGGTAGG - Intronic
1051599161 9:18854940-18854962 CTTACCCTGGAAAATGGGGAGGG - Intronic
1052048045 9:23818128-23818150 CTACACCTGTAAAATGAAAATGG + Intronic
1052970304 9:34373256-34373278 CTCCACTAGGAAAATGAGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1055139395 9:72858566-72858588 CCTCCCCTGTAAAATATGGAAGG + Intergenic
1055553347 9:77451234-77451256 CCTCATTGGTAAAATGAGGAGGG + Intronic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056213709 9:84389001-84389023 CTTTAGCTTTAAAATGAGGTGGG - Intergenic
1056461169 9:86810933-86810955 CCTCACATGGAAAAGGAGGAAGG - Intergenic
1056739749 9:89244211-89244233 ATTCACCTGTCAATGGAGGAGGG - Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057180734 9:93028716-93028738 CCTCACCTGTAAAATGGGATGGG - Intronic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1057744547 9:97741020-97741042 CCTCACTGGTAAAATGAGAAGGG + Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058542196 9:106023100-106023122 ATTCTTCTGTAAAATGAGGTAGG - Intergenic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1059938430 9:119334652-119334674 CTGCACCTGTGCAACGAGGAAGG + Intronic
1059972243 9:119679641-119679663 ATCCATCTGTGAAATGAGGATGG + Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060839460 9:126782319-126782341 TTTCATCTGTCAAATGAGCACGG - Intergenic
1061008833 9:127943512-127943534 CTTCACCTGTCAAGTGGGGCAGG - Intronic
1061017940 9:127993483-127993505 CTTCAACTGTGAAGTGAGGATGG - Intergenic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1062099107 9:134718821-134718843 CTGCATCTGTGAAATGGGGATGG + Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1185943979 X:4353754-4353776 CTTCATCTATAAAGTGGGGATGG + Intergenic
1186444151 X:9611826-9611848 CCTCACATATAAAATGGGGATGG - Intronic
1186531176 X:10297297-10297319 CTATAACTCTAAAATGAGGATGG + Intergenic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186567553 X:10679809-10679831 CTTCACCTACAAAGTGATGAAGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1186681975 X:11884244-11884266 TTTCACCTTTAAAATCATGATGG + Intergenic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1187256773 X:17650401-17650423 CTTCATCTATAAAATAAGGAGGG - Intronic
1188128794 X:26404423-26404445 CTTCATTTGTAATATGAGAATGG - Intergenic
1188272547 X:28158455-28158477 CTTCACCTTCAAAACGAGCATGG + Intergenic
1188607895 X:32055237-32055259 CTCCACCTCTAAAATGACTAGGG + Intronic
1188928328 X:36073630-36073652 CCTCATCTGTGATATGAGGAAGG + Intronic
1188960988 X:36491159-36491181 CTTCACCTGCTACATGGGGAAGG - Intergenic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189559673 X:42179071-42179093 CTTTGCCTGTAAAATGGGGGAGG - Intergenic
1189753283 X:44245033-44245055 CTTCCCCTATGAAATGAAGATGG - Intronic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190227127 X:48554872-48554894 CTTAACAGGTAAAATGAAGAAGG - Intronic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191912042 X:66161552-66161574 CTTCACCTATAACATGAAAAAGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1193931491 X:87558285-87558307 TCTCATTTGTAAAATGAGGACGG + Intronic
1196013794 X:110916066-110916088 CCTCACCTATAAAATCAGGATGG - Intergenic
1196262755 X:113603957-113603979 CTTCACCTGTAGCAAGAGGAGGG + Intergenic
1196401982 X:115326281-115326303 CACCAGCTGTAAAATGAAGAAGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197296783 X:124728874-124728896 CTTCATCTCTCAATTGAGGATGG + Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197893374 X:131287240-131287262 GTTCATCAGTAAAATGGGGATGG - Intronic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1197974020 X:132145947-132145969 CTTCGTCTCTAAAATGTGGAAGG - Intergenic
1198099442 X:133412081-133412103 CTTCACCTGGAAAATGATCCTGG + Intronic
1198103068 X:133438590-133438612 CTTCATCTGTAAACTGAAGGTGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198506878 X:137309718-137309740 CTTCATCTATAAAATAAAGATGG - Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199684597 X:150255017-150255039 CTCCAGCTGAAGAATGAGGATGG + Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1202174362 Y:22084094-22084116 TTTCACCTGTAAAATAGAGATGG - Intronic
1202216998 Y:22502288-22502310 TTTCACCTGTAAAATAGAGATGG + Intronic
1202326189 Y:23693782-23693804 TTTCACCTGTAAAATAGAGATGG - Intergenic
1202544583 Y:25976272-25976294 TTTCACCTGTAAAATAGAGATGG + Intergenic